Yellows, reds, and golds

Not many fall pics this year. My favorite trail is sill closed due to Las Conchas fire. Sigh.

Photos: focal length 85mm, f-stop 14, ISO 100. Shutter speed: top, 1/100, bottom 1/80.

Murder is her day job!

No, it's not "Murder, she wrote," it's... "Murder, she analyzed"!

Lisa Black is a forensic scientist and the New York Times best selling author of the Theresa MacLean suspense novels Defensive Wounds, Trail of Blood, Evidence of Murder, and Takeover. After spending five years at the Cuyahoga County Coroner’s Office, analyzing gunshot residue on hands and clothing, hairs, fibers, paint, glass, DNA, blood and many other forms of trace evidence (the "happiest years of her life," she writes in her bio), Lisa is now a latent print examiner for the city of Cape Coral, Florida, police department, working mostly with fingerprints and crime scenes.

And when she gets home from her day job... she writes gripping, grab-by-the-throat suspense novels! It is my great pleasure to have Lisa Black as my guest today!

EEG: Lisa, I'm insanely curious about your day as a forensic scientist: what is it like?

LB: There is no such thing as the average day, and if there were it would still depend on where you work and what your agency does. At the coroner’s office I would usually be examining victim’s clothing, typing blood (this was a while ago), running gunshot residue samples through the spectrometer and analyzing hairs and fibers. At the police department I spend 90% of my time sitting in front of a computer looking at fingerprints, and the rest photographing and processing crime scenes (usually burglaries) and evidence.

EEG:  Did you always write or was it your job that one day sparked the writing muse?

LB: I wrote first, starting in grade school, back when I wanted to be a pilot, archaeologist, ballerina or astronaut. But I always wrote mysteries.

EEG: From what I've learned about forensic sciences, you have to be very meticulous in collecting the evidence and analyzing it. Do you think this ability helps you in your writing, too?

LB: Yes. I grew up reading the classical mysteries of Ellery Queen and Agatha Christie, so it’s important to me that every last factor is realistic and fits into a pattern. There is an overwhelming amount of attention to detail in a mystery story.

EEG: How much of your heroine Theresa MacLean do you see in yourself?

LB: All of it, which is a problem. I need to let her be herself instead of what I want her to be, which is me only stronger, faster, smarter and divorced.

Well, you never know, characters do have the tendency to surprise even their authors, sometimes!

Thanks so much, Lisa, for taking the time to answer my questions. To find out more about Lisa Black and her best selling novels, visit her at www.lisa-black.com.

Are vaccines the future of cancer treatment?

The September issue of the Cancer Journal is dedicated to cancer vaccines and how they may hold the key for cancer treatment and prevention. This is not to be confused with vaccines against cancer-causing viruses, like HPV. In that case the vaccine elicits antibody responses against the virus. In the context of cancer, though, a vaccine would use the immune system's own weapons in order to destroy tumor cells. An example is the vaccine to treat advanced prostate cancer that was approved by the FDA in April 2010, after a Phase III trial showed that patients who received the treatment survived longer than the controls.

The main question in order to create a vaccine that targets cancer cells is: how do we tell the immune system which are the cells to destroy? There is a particular class of cancer cells that offers a potential candidate: cancer stem cells.

Stem cells are a class of very special cells because they are undifferentiated, which means they have the potential to generate any kind of tissue (heart, lung, skin, etc.) Seems almost a paradox, doesn't it? Stem cells can remain undifferentiated and at the same time differentiate into specialized tissue cells. This is possible through an asymmetric cell division: every time a stem cell divides, it generates two cells, an undifferentiated stem cell, and a differentiated one. This way, the differentiated cells produce the specialized tissue, while the stem cell population remains intact.

In a healthy individual, cells with this capacity are found in the bone marrow and in umbilical cords. Unfortunately, they have also been found in solid tumors, such as breast cancer, prostate cancer, and melanoma. You can immediately see the problem: if a cancer cell remains undifferentiated, it means it can preserve its population while generating new cancers in other parts of the body -- the process known as metastasis.

Therefore, one way to produce a cancer vaccine is to have it elicit immune responses against cancer stem cells [1]. How? The idea is to use proteins, or even bits of proteins (peptides) that are over-expressed on tumor cells. Vaccines that use peptides as antigens are called anticancer peptide vaccines [2], and right as I was reading about them, one of the authors of this paper [2] wrote this wonderful article on Scientific American, which describes in great detail the history and ideas behind a cancer vaccine. Quoted from the S.A. article:

"Basically, there are three elements to making a cancer vaccine. The first is to decide precisely what molecular feature, or antigen, in a malignant tumor the immune system should recognize as foreign and target for killing. The second is to decide how to deliver a triggering agent (or vaccine) to the immune system that ramps it up to attack cancer cells. And the third is to decide which cancer patients to treat and when during the course of their disease to administer the vaccine."

Mutated cancer cells arise normally (in small quantities) in the body and a healthy immune system is normally capable of recognizing them and destroying them. A vaccine would make this kind of response stronger and robust enough to wipe out all malignant cells. Unfortunately, as cancer progresses, the immune system gets severely damaged. Therefore, the key for this strategy would be to either act fast enough (when the tumor is still small), or combine it with other strategies like chemotherapy.

In the September issue of the Cancer Journal, Dhodapkar et al. [1] review what the future holds in cancer vaccine research, whereas Larocca et al. [3] discuss viral vectors, in other words, how viruses could be engineered to deliver a cancer vaccine.

[1] Dhodapkar MV, & Dhodapkar KM (2011). Vaccines targeting cancer stem cells: are they within reach? Cancer journal (Sudbury, Mass.), 17 (5), 397-402 PMID: 21952290

[2] Perez SA, von Hofe E, Kallinteris NL, Gritzapis AD, Peoples GE, Papamichail M, & Baxevanis CN (2010). A new era in anticancer peptide vaccines. Cancer, 116 (9), 2071-80 PMID: 20187092

[3] Larocca C, & Schlom J (2011). Viral vector-based therapeutic cancer vaccines. Cancer journal (Sudbury, Mass.), 17 (5), 359-71 PMID: 21952287



Photo: focal length 85mm, shutter speed 1/160, f-stop 16, ISO 400.

Facebook and the unselfish gene

So I finally did it. As some of you regulars may have noticed, I put the blog on Facebook. And then I instantly became needy and sent out a bulk of emails begging people to like me. I sent out five and since they're very nice friends of mine, they all liked me. And then I thought, "Well, now, my friends' friends' will like me, and then my friends' friends' friends', and then..."

Hmm. That got me thinking. Does it work like with viruses? No, seriously, do "likes" spread like a viral infection in the body? If not, what kind of network do they resemble? Neurons? Random walks? Traffic network? Surely somebody has thought of modeling this -- does anybody know?

I really got curious about this. I logged onto PubMed and did a search under the keyword "Facebook." I got around 200 hits, none of which answered my questions, but I did find a few papers that captured my attention, so I thought I'd list them below.

• The unselfish gene [1]. Species compete for resources. We've learned in school that natural selection is a competition among the fittest. Philosophers like Hobbes and Machiavelli have stated that humans are essentially selfish, pushing societies to promote self-interest with the use of incentives and punishments. In his review, Dr. Benkler looks at how this line of thinking has changed in the past few years. In fact, we now believe that evolution selects cooperation over competition. The evidence, according to Benkler, doesn't come from evolutionary biology only, but also from sociology, psychology, and economics. And to prove his point, Benkler points to the success of social networks like Facebook, Craigslist, and LinkedIn, which provide emotional, social, and psychological support, gratification, and a great deal of information resources. The sharing of information that goes through the Internet is an indication of cooperation. Indeed, my PubMed search yielded many results on the benefits of Facebook and social networking when it comes to health support groups, health care, and advantages of networking for medical practices. So, I completely agree, except I do find Facebook a little selfish when it comes to... self-promotion. Ahem, yes, I confess I am myself guilty of the crime, since I put my blog in there out of a selfish, egotistical need to have readers...

• Facebook is smoking [2]. This one sounded intriguing. Does the title imply that Facebook is as addictive as smoking? Or that it's as cancerogenic as smoking? Or maybe, Facebook is smoking on your computer after so much use? Unfortunately, I couldn't find anything besides the title, not even the abstract.

• Mirror, mirror on my Facebook wall: effects of exposure to Facebook on self-esteem [3]. Does Facebook enhance or diminish self-esteem? My intuition would be that it requires some solid self-esteem to put yourself "out there." The debate is still very much open, however, some of the literature* seems to indicate that Facebook has beneficial effects on self-esteem. So, stop hiding! Find the guts, go out there, and you'll be a better person! (Yes, yes, I am indeed preaching to myself! Again, guilty.)

* In my literature search, unfortunately, there were numerous papers I didn't have access to.

All of the above is fascinating and interesting, but what about the networking model? I still think a viral infection model might work: you need to re-define parameters such as fitness cost and effective population size. For example, you might send the request to "like you" to, say, 10 friends, but only the ones who will actually click on the like button are the ones who actually "replicate." Say you get 7 likes. Now, all the 7 friends' friends will see the likes, but how many will go ahead and click the like button in turn? That's the effective size population, how many "likes" will actually generate new "likes." In this model there's no immune pressure, but if the effective size is too small, then the infection doesn't take off.

Obviously, this is just my speculations, so I did a second PubMed search and this time I typed "Facebook viral," hoping I'd get some insight on whether Facebook "likes" spread like a virus. This is the only entry I got:

• Using the Internet and social media to promote condom use in Turkey [4]. Not exactly what I meant in my search, but look at the bright side -- another Facebook success story.

That's all for today. Short post, I know, but hey, all those refreshing clicks on FB to check the number of likes, it's a lot of work, you know?

... Pssst. Hey. If you happen to have a spare second, would you click on the like button up there? ...

Okay, those last two statements were jokes. Seriously. Just give me a pat on the back and my self-esteem will thrive. Promise.

[1] Benkler Y (2011). The unselfish gene. Harvard business review, 89 (7-8) PMID: 21800472

[2] Mgweba L, Dlamini S, Kassim J, Planting T, & Smith D (2009). Facebook is smoking. South African medical journal = Suid-Afrikaanse tydskrif vir geneeskunde, 99 (11) PMID: 20222194

[3] Gonzales AL, & Hancock JT (2011). Mirror, mirror on my Facebook wall: effects of exposure to Facebook on self-esteem. Cyberpsychology, behavior and social networking, 14 (1-2), 79-83 PMID: 21329447

[4] Purdy CH (2011). Using the Internet and social media to promote condom use in Turkey. Reproductive health matters, 19 (37), 157-65 PMID: 21555096

Photo: last dahlias of the season! Focal length 85mm, F-stop 20, shutter speed 1/50, ISO 100. A special thanks goes to my neighbor who does an amazing job growing these beautiful flowers and then kindly lets me photograph them.

So, how does one become a computational biologist?

(Starting today, for the next two weeks, I will be guest blogging over at Scientopia, which means that the posts here will be cross-posted over there, too. As a first post, I thought I'd tell the story of how I ended up being a computational biologist. Forewarning: there are better and more linear ways to become a computational biologist. But, as we all know, life is hardly ever linear.)

I used to think genes dictate what we can be and the choices we make dictate what we end up being. Well, that's not quite true. I haven't accounted for opportunities.
When I finished college I wanted to be a mathematician. Math is pure and beautiful. It's like a Michelangelo painting, perfect all around. You follow the steps dictated by logic and you can't be wrong. It's Socratic. I got accepted into graduate school, and my husband arranged to finish his dissertation off site so we could both go. We fit all our belongings into two suitcases (that's all we had) and left. We were young, enthusiastic, and clueless.

The bus left us in the middle of nowhere in Massachusetts. The motel we'd booked was five miles away. A lady took pity on us and gave us a ride. I forgot the lady's name, but not her baby's: Timothy. He was the cutest baby.

I grew tired of doing pure math. Yes, it's beautiful and perfect. There's Banach spaces, and then Hilbert spaces, and then Banach spaces of Hilbert spaces, and Hilberts of Banachs of Hilberts... I felt lost in one of Dr. Seuss's pictures. Oh, the thinks you can think... Yes you can, but do you want to?

(My mathematician friends, please don't hate me. I'm in confession mode, so bear with me.)

So when my husband got a postdoc in Vienna, Austria, we packed again and left. By then we had four suitcases and a baby. In Vienna I started freelance writing. I wasn't paid a penny but it was fun.

Vienna is beautiful, by the way. If you have enough money to enjoy it. We didn't.

The following year we moved to Valencia, Spain. We had four suitcases, five boxes, and a baby. Two years later we moved to Pasadena, California. We had four suitcases, twenty boxes, and two babies. Gosh, it's exponential, isn't it? Not the baby part, though. We stopped at two and glad we did.

In Pasadena I started missing my job. Did I mention I felt poor in Vienna? Haha, that was nothing compared to Pasadena! That's what Southern California does to you. I looked around but as it turns out with a degree in pure math there's not much you can do besides teaching. And I wasn't much into teaching. I continued to do freelance writing, and even though by now I was getting paid a little, it definitely wasn't enough.

So I decided to go back to school.

I applied to the biomath program at UCLA, the computational biology program at USC, and the biostat program at USC. I got accepted to all three of them. At the time I was stubbornly convinced that I could survive in Southern California without ever getting on a freeway.
Haha.

I got up one morning at 4 a.m., took a bus, and three hours later I was at the UCLA campus, which is a whole city within a city. Never seen a campus that huge. The commute drained me. The next day I went to downtown to check out the USC computational biology department. The faculty there is impressive--gods in the field. Now that I knew I wasn't going to be a mathematician, I really wanted to become a computational biologist. That's where all the cool stuff was happening--genetics, protein folding, sequencing. And, they even offered me a scholarship.

Unfortunately, the USC downtown campus is not in a charming part of town (to put it in mild terms). And again, the commute from where I lived was going to be a killer. 

Finally, I went to the USC medical campus, which turned out to be ten miles down Huntington Drive from where we lived (no freeway! Can you believe it? I could get somewhere in LA county without getting on the freeway!), and met another god.

There's many gods in my life.

Stan is fantastic. If you live in Pasadena, go listen to him play the piano at the Parkway Grill on Thursday nights. He's amazing.

So, anyways, I got into the biostat program. Like I said, Stan is fantastic, and the no-freeway thing sealed the deal.

Statistics is not beautiful. You know the old saying: "There's lies, there's damn lies, and then there's statistics"? Well, it's true. I set off wanting to do pure math, which is perfect and beautiful, and here I was, doing dirty and very much imperfect stuff. But it's useful. And life, the way we describe it, is very much imperfect. So there. You can't apply perfect and beautiful to real life.

I decided I wanted to be a biostatistician. Even got a job as one. By then I could handle Californian freeways. Sort of. I still screamed from time to time. And I still got off at the wrong exits and stuff like that. But hey, the adrenaline high the morning commute down the Two-Ten gives you is unbeatable! (I don't miss it, BTW).

And then my husband had us move again. This time we filled a truck. Heck, give it enough time, you start buying furniture! No, let me rephrase that: give it enough time and a close enough Ikea.

On a side note, my husband hates Ikea. He's the one who has to decipher the cryptic drawings.

We moved to a remote part of Northern New Mexico, so remote that for a while it was only known as a "mail stop." But that's another story. For now, all I will say is that it's not the desert. It's got mountains, and trees, and forests, although the forests do tend to burn down every ten years or so...

Anyways, I'm getting carried away. The point I wanted to make is that we came out here and I met yet another god, my wonderful, amazing, gracious mentor. And guess what I ended up doing? Computational biology. Yeah, where all the cool stuff is happening.

Looking back, I did choose to become a computational biologist, didn't I?

Photo: water creek, Twin Falls, WA. Canon 40D, shutter speed 1/20, focal length 85mm, ISO 400.

How a real photographer takes pictures at the Balloon Fiesta...

Hot Air Balloon Picture - National Geographic Photo of the Day
The real photographer is Bruce Dale, whose work is amazing (check it out!).

Learning neuroscience from a virus

Back in college, the shortest theorem proof I sat through in class (I was a math major) was the following: "Suppose the topological manifold is a chunk of cheese. Put a mouse on one of the cells and wait until the mouse has eaten all of the cheese." The cells, in that context, weren't biological cells, but rather topological ones. Believe me, it was a real proof and, once you worked out the details, it held.

So now suppose that instead of cheese you have a brain, and instead of topological cells you have neurons. What would the mouse be?

The nervous system processes information through a network across neurons. Neurons communicate exchanging signals (either chemical or electrical) through synapses. These network exchanges across neurons can be reconstructed with the use of chemical tracers, which allow researchers to visualize the activity of a specific neuron with its neighbors. However, chemical tracers have limits: not all of them can trace the "output" signal from a neuron, and not all of them are able to cross synapses. A study recently published in PNAS [1] presents a new way to trace neural circuits, using... guess what? Yes, you've guessed it: a virus. Pretend the brain is a chunk of cheese and let the virus "eat it all up." Well, okay, in principle.

With the disclaimer that neuroscience is not my field (but I'm always fascinated by any creative use of viruses), let me give you my two-cent-worth understanding of what was done. 

The authors genetically modified VSV, the vesicular stomatitis virus, enabling it to travel back and forth across synapses.  They placed a fluorescent reporter upstream of the viral proteins, and then they injected it into a mouse model. The virus used the communication network established by the neurons to infect the brain tissue. Basically, the path of infection followed the neural network in the mouse brain. Pretty cool how these pesky little viruses come in handy!

[1] Beier, K., Saunders, A., Oldenburg, I., Miyamichi, K., Akhtar, N., Luo, L., Whelan, S., Sabatini, B., & Cepko, C. (2011). From the Cover: Anterograde or retrograde transsynaptic labeling of CNS neurons with vesicular stomatitis virus vectors Proceedings of the National Academy of Sciences, 108 (37), 15414-15419 DOI: 10.1073/pnas.1110854108

This will make your jaw drop...

Aurora Borealis in Finnish Lapland 2011 from Flatlight Films on Vimeo.

Make sure to watch it in full screen.

Gene therapy makes sense. And antisense, too!

Genes code proteins. When a gene carries a defective mutation, it will either stop coding the protein or it will code a defective one. This is, unfortunately, the basis of many genetic diseases. In principle, if we could substitute the defective gene with a healthy one, the problem would be solved. That's what gene therapy boils down to. In fact, there are ways to deliver the genes to the affected cells. For example, you can take a virus that targets the cells where the defective gene is expressed, keep the virus's ability to inject its genome into the target cell, but modify its genetic content so that now it contains the healthy genes. The virus will "attack" the target cell in its usual manner and inject its genetic content inside. But now, because the virus has been artificially modified, the new genetic content won't be the usual viral genes that cause infections. Instead, they will be the new, healthy genes, which will be integrated in the cell's DNA and start coding the healthy protein.

Gene therapy has been used successfully to treat various genetic diseases (see the studies listed here) and there have been very encouraging results when used to treat cancer in mouse models (see, for example, [1]) as well as in humans [2].

However, there are situations where the "simple" scenario I described above will not work. 

We are diploid organisms, which means we carry two copies of each chromosome, and hence two copies of each gene. The two copies may or may not be identical. When they differ, we say that the individual is heterozygous at that particular locus. Now, it so happens that in some heterozygous individuals one of the two copies of the gene is dominant negative. What that means is that even if the other copy is healthy, and it codes a healthy protein, the defective protein (produced by the defective gene) interacts with it and alters its function. Basically, the mutated protein dominates over the non-mutated one and overrides its ability to function properly.

When this happens, "delivering" the healthy gene will not solve the problem because the defective gene will continue to produce the defective protein, which, in turn, will override the effect of the healthy one. Does this mean we can't use gene therapy to fix the defective gene? Of course we can! We just have to use a different kind of gene therapy, namely antisense gene therapy.

This is how it works.

I've used the expression "genes produce proteins." Well, it's a little more complicated than that. Each strand of DNA gets first transcribed in RNA and then the RNA (which is single stranded) is translated into the protein. The idea behind antisense gene therapy is to prevent the defective RNA strand to be translated into the defective protein. How? By binding the defective RNA before it can be used by the cell to make the defective protein.

DNA is made of two strands that are complementary to each other. The same principle works for RNA, even if RNA is usually found in single strands. So, if you make its complementary (the antisense strand), it will bind to it like opposite magnets do. And that's exactly what antisense gene therapy does: instead of delivering pieces of DNA, it delivers pieces of antisense RNA made to complement exactly the defective RNA.

The figure below is from this website:

As you can see from the figure, the defective RNA is "plugged" by its antisense complement and at that point is no longer able to make the defective protein. The healthy protein, produced by the unmutated copy of the gene, completely takes over thus eliminating the source of the disease.

References [3] and [4] below show examples of antisense gene therapy used in treating brain and cervical cancers. 

[1]  Suto, R., Tominaga, K., Mizuguchi, H., Sasaki, E., Higuchi, K., Kim, S., Iwao, H., & Arakawa, T. (2004). Dominant-negative mutant of c-Jun gene transfer: a novel therapeutic strategy for colorectal cancer Gene Therapy, 11 (2), 187-193 DOI: 10.1038/sj.gt.3302158

[2] Morgan RA, Dudley ME, Wunderlich JR, Hughes MS, Yang JC, Sherry RM, Royal RE, Topalian SL, Kammula US, Restifo NP, Zheng Z, Nahvi A, de Vries CR, Rogers-Freezer LJ, Mavroukakis SA, & Rosenberg SA (2006). Cancer regression in patients after transfer of genetically engineered lymphocytes. Science (New York, N.Y.), 314 (5796), 126-9 PMID: 16946036

[3] Zhang Y, Zhu C, & Pardridge WM (2002). Antisense gene therapy of brain cancer with an artificial virus gene delivery system. Molecular therapy : the journal of the American Society of Gene Therapy, 6 (1), 67-72 PMID: 12095305

[4] Yatabe, N., Kyo, S., Kondo, S., Kanaya, T., Wang, Z., Maida, Y., Takakura, M., Nakamura, M., Tanaka, M., & Inoue, M. (2002). 2-5A antisense therapy directed against human telomerase RNA inhibits telomerase activity and induces apoptosis without telomere impairment in cervical cancer cells Cancer Gene Therapy, 9 (7), 624-630 DOI: 10.1038/sj.cgt.7700479

Balloon Fiesta 2011

So I finally went, and it was totally worth it.

Photos: Albuquerque International Balloon Fiesta. Tripod and shutter speed ranging between 1/8 of a second 1/4.

Deep sequencing and forensic science: how to improve DNA fingerprinting

(In case you missed it, this originally appeared last Thursday as a guest blog on the Writer's Forensics Blog.)

There are roughly three billion pairs of nucleotides in human DNA, and the vast majority is identical across individuals. When we talk about “genetic fingerprinting,” we really mean, “looking for a needle in a hay stack.” Luckily, for the most part, we all differ at the same loci. Over the years, the techniques used for DNA typing have improved greatly, diminishing both costs and the likelihood of errors. These days, most forensic laboratories use commercial kits to type specific regions of the DNA that are known to vary across the population. Here in the US, the standard for DNA fingerprinting is to type 13 loci called short tandem repeats (STRs), regions that are 4 or 5 nucleotides long. The likelihood of two individuals having all 13 loci identical is so low that we can deem it virtually impossible (with the exception of identical twins, of course).

Using PCR-based technology (which creates many clone sequences out of a small sample), the commercial kits can rapidly determine the 13 STR alleles even from old, partly degraded DNA. These alleles are then run through CODIS, the DNA database maintained by the FBI, and if the genetic profile is already in the system, a match can be determined.

However, there’s a catch, and it’s called microvariant. From time to time, an individual will have a mutation that is so uncommon it’s never been observed before. The commercial kits are made to recognize specific variants that have already been documented, so when the DNA with the rare mutation is analyzed, the kit will not be able to recognize it. This can potentially lead to mislabeling.

How can we buld a reliable library of STR alleles that faithfully represents the whole population? Until a few years ago, the two sequencing methods available — the chain-termination method (Sanger et al., 1975), and pyrosequencing (Ronaghi et al., 1996) — yielded tens of sequences at the time. The breakthrough came in 2005, when 454 Life Sciences, a biotechnology company based in Branford, CT, invented a new fiber-optic chip that allowed the typing of tens of thousands of DNA sequences [1]. The new method is called 454 sequencing or ultra-deep sequencing.

For those of us working in HIV research, this was a breakthrough. Since we had already shown that only a handful of viruses are transferred during a sexual transmission, deep sequencing allowed us to type the genome of those transmitted viruses, shedding new light on vaccine design.

But what about forensic analyses?

Researchers from Denmark used deep sequencing to analyze five STR loci and found rare base mutations and repeat variations that would have not been found using conventional methods [2]. As mentioned before, in order to reduce typing errors, it’s important to find these variants and incorporate them in the commercially available typing kits. Here in the US, a similar analysis is ongoing at the Forensic Science Program of the Western Carolina University. The goal of the study, led by Professor Mark Wilson, is to understand how deep sequencing can uncover minor variants and hence minimize the rate of inconclusive results from genetic fingerprinting analyses.

In conclusion, just like its name implies, deep sequencing can give us a new depth to DNA sequencing, unveiling new, previously unknown alleles in the population.

[1] Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature, 437 (7057), 376-80 PMID: 16056220

[2] Fordyce SL, Ávila-Arcos MC, Rockenbauer E, Børsting C, Frank-Hansen R, Petersen FT, Willerslev E, Hansen AJ, Morling N, & Gilbert MT (2011). High-throughput sequencing of core STR loci for forensic genetic investigations using the Roche Genome Sequencer FLX platform. BioTechniques, 51 (2), 127-33 PMID: 21806557

Photo: red glass in iron cast. Focal length 85mm, shutter speed 1/50, F-stop 5.6, ISO 100. I know, it's a weird picture... It vaguely reminded me of a jumbled fiber-optic chip... very vaguely, though...

The power of healing: Carol Cassella on being a best selling author, a mom, and an "invisible doctor"

If writing were like painting, Carol Cassella's prose would be an Edward Burne-Jones: luminous, reflective, and perfect even in the smallest details. Dr. Cassella is an anesthesiologist, a novelist, and (the most impressive task, in my opinion!) the mother of two sets of twins. Her first novel, the national bestseller Oxygen, was an Indie Best Pick for July 2008, and selected as one of the best first novels of 2008 by The Library Journal. Her books portray the humanity behind the world of medicine, where healing has to overcome ambition, greed, and weaknesses.

It is my great pleasure and honor to have Dr. Cassella as a guest on my blog today!

EEG: You worked for a while in publishing, before deciding to go back to school and study medicine. Looking back, how important was this decision in becoming the accomplished writer you are today?

CWC: I worked in publishing after graduating from college solely because I loved books and wanted to work around them and among the people who created them. I had harbored dreams of being a writer from the time I learned to read, and stumbling into a job with a publisher was the closest approximation I could find that actually paid my rent. Only problem was, the job I had was selling textbooks for an academic publisher--pretty far cry from my own goals. But I think it was a first step toward realizing that books are not spun in a vacuum. They are the product of many minds and many hands and there is a very concrete business model that underlies their production and distribution. That lesson has certainly stuck with me and helped me navigate some of the mysteries of being a published author. I do wish, though, that I had continued writing fiction more consistently from my childhood. Think how many more words I would have under my belt by now?

EEG: Oh, but books aren't made of just words, as I'm sure you already know! Even when you're not writing, you're experiencing the world as a writer...

I've read many novels about surgeons, medical examiners, ER doctors. Oxygen was the first book I read where the protagonist is an anesthesiologist, and I loved it: it gave me all these insights into a field I knew so little about. I'm curious: of all medical fields, what made you choose anesthesiology?

CWC: I have been an anesthesiologist working in a major hospital's operating rooms for more than fifteen years now, and I still find that work fascinating and uniquely challenging. Even after medical school I didn't fully appreciate all that an anesthesiologist does for their patient. In fact, I became an internist and worked in both public and private clinics for three years before I returned for three more years of training in anesthesia. We are "invisible doctors" in a way--we are usually assigned to our patients on the day of surgery, rather than being chosen by our patients in advance. We talk to our patients for only a few moments before they are sedated or asleep, so they often have no idea of all that we do for them while their surgery takes place. The trust and vulnerability of that role is mind boggling, when you really think about it. And most of us require anesthesia at some point in life; the average American has seven surgeries before they die. I chose the field because I wanted to focus on one patient at a time, which is impossible in most specialties. I love the procedures involved in anesthesia--it is a very tactile field that requires both intellectual decisions and precise manual dexterity for placing nerve blocks, epidurals, intubations, etc. There is also the benefit that I could have a little more control over my hours and with a young family that makes the combination of medicine and mothering more practical. I could work part time as an internist, but only by sharing my patients with another physician, who might not know them as well.

EEG: In your last book, Healer, your protagonists find wealth and comfort through a break-through blood test and then, just as easily, they lose everything. This dichotomy in medicine -- the moral need to heal versus the profit aspect -- is a topic I'm particularly sensitive to. My research is in HIV and vaccine development, and because of that I see with my own eyes the costs of vaccine research while trying to reach out to the poorest parts of the world, where HIV has the highest prevalence. Tell us about your new book, Healer, and what inspired you to write it.

CWC: Ooh. You are touching on a subject close to my heart. For several years I wrote articles for the Bill & Melinda Gates Foundation about vaccine trials and disease prevention in the developing world, and I know quite well the disparities that exist in health care. It is a conundrum--drug and vaccine development is phenomenally expensive and poor countries can't afford it. But those industries are also phenomenally profitable and invest mightily in lobbying our own congress. How do we incentivize medical breakthroughs but also realize the moral, equal distribution of those discoveries? And, of course, we face the same dilemmas here in the United States. We have very unequal access to care. In Healer I was also quite interested in wealth acquired by any means, and how it affects our view of ourselves, our rights, our relationships, and our expectations. In some ways I saw the story as a parable for what our country experienced in the nineties--money that flowed in too easily, seemingly unlimited loans with loose fiscal reins. And here we are. Redefining what is normal!

EEG: I hear you. And with the current budget cuts things are as hard as ever. My boss has a beautiful photo of two African children in her office. They are smiling and playing and you would never guess they are AIDS orphans. When I'm having a bad day at work I look at that photo. It puts things back in perspective.

Carol, thanks so much for taking the time to answer my questions! And thank you for being an advocate for these issues and raising awareness on the costs and struggles of medical research. Your books are amazing and I truly look forward to your next novel.

Dr. Cassella currently practices anesthesia in Seattle and has been a freelance medical writer specializing in global public health advocacy for the developing world. Her new novel, Healer, was released last June. Visit her website to find out more about her books and her public lectures.

The two ends of the spectrum

E.L. Doctorow said: "Writing is a socially acceptable form of schizophrenia."

Then, by analogy, scientific research must be a socially acceptable form of autism.

Photo: Sculpture by Susan Stamm Evans, Santa Fe, NM. Focal length 38mm, F-stop 9, shutter speed 1/50, ISO 100. What I love most about this sculpture is that you can tell without any doubt that they are a man and a woman, and yet, if you look closely, the differences are so subtle. Chin, nose, and proportions. Wow!

Like watercolors

Picture: dry storm at sunset. Canon 40D, focal length 17mm, exposure time 1/25.

Overlapping genes, nested genes, and antisense genes: how complex can genomes be?

HIV has 10 genes spread throughout roughly 10 thousand nucleotides. The genes Rev and Tat (and Tev, when it’s present), completely overlap with the larger gene Env. When a gene lies within another, we say that the two genes are “nested.”

How does the virus know which protein to code if the information is overlapping? The key is the “reading frame.” Remember, a gene is a string of nucleotides (A, G, C, and T), and a protein is a string of amino acids (also denoted with letters), so it really boils down to translating the string of nucleotides into one made of amino acids. It takes three nucleotides (each triplet is called a "codon") to code one amino acid. So, suppose you have a string of DNA that looks like this (the example is taken from this wonderful site):

ATGCCCAAGCTGAATAGCGTAGAGGGGTTTTCATCATTTGAGGACGATGTATAA

The three nucleotides in green on the left make the five-prime end, where the translation starts, and it can start at any of the three "green" nucleotides. Now, if you begin reading from the A, you get one reading frame, if you begin from the T, you get a second frame, and, lastly, if you begin from the G you get a third one. Like this:

ATG|CCC|AAG|CTG|… becomes MPKL…

  TGC|CCA|AGC|TGA|… becomes CPS…

    GCC|CAA|GCT|GAA|… becomes AQAE…

As you can see, a single strand of DNA can have three possible reading frames because, depending on where you start partitioning the DNA, the triplets change, giving rise to different sequences of amino acids. At this point, you’re probably wondering why go through all this trouble.

Overlapping and nested genes are not uncommon in organisms like virus and bacteria, which have very short genomes (compared to us). For these organisms, a compact genome means a speedier replication process, which is evolutionary advantageous [1].

But how do you explain overlapping genes in more complex organisms like mammals [2]? Our genome is huge compared to that of a virus, and, like I’ve said many times before, it’s mostly non-coding. If there’s plenty of room for extra genes, why do we have overlapping ones?

It gets even more complicated. HIV carries RNA, which is single-stranded, hence, the three reading frames. But we have two strands of DNA, hence six possible reading frames, and some overlapping gene pairs in our genome are indeed transcribed on opposite strands of DNA. These pairs are called sense-antisense gene pairs, and we really don’t know their function. One reason they exist could be that they simply are a remnant of evolution [1]. However, recent studies have shown that these gene pairs may be associated with cancer [3] and diseases such as Alzheimer [4]. In fact, a mutation in the overlapping regions “doubles” its effect in a way, since it affects both genes.

Such associations should not be completely surprising and in fact, I believe they are the tip of some deeper regulatory mechanism that we have yet to understand. If we go back to our very first ancestors, bacteria, we see that these primitive organisms have evolved complex regulatory mechanisms based on sense-antisense genes. These mechanisms have been studied in particular in the context of drug resistance, where it has been shown that this type of “antagonist” transcription has a role in controlling how bacteria exchange genetic material [5], and, as a result facilitate the rise of drug-resistant subspecies. I should explain this phenomenon more in detail in a later post.

[1] Kumar A (2009). An overview of nested genes in eukaryotic genomes. Eukaryotic cell, 8 (9), 1321-9 PMID: 19542305

[2] Sanna CR, Li WH, & Zhang L (2008). Overlapping genes in the human and mouse genomes. BMC genomics, 9 PMID: 18410680

[3] Yu W, Gius D, Onyango P, Muldoon-Jacobs K, Karp J, Feinberg AP, & Cui H (2008). Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature, 451 (7175), 202-6 PMID: 18185590

[4] Guo JH, Cheng HP, Yu L, & Zhao S (2006). Natural antisense transcripts of Alzheimer's disease associated genes. DNA sequence : the journal of DNA sequencing and mapping, 17 (2), 170-3 PMID: 17076261

[5] Chatterjee A, Johnson CM, Shu CC, Kaznessis YN, Ramkrishna D, Dunny GM, & Hu WS (2011). Convergent transcription confers a bistable switch in Enterococcus faecalis conjugation. Proceedings of the National Academy of Sciences of the United States of America, 108 (23), 9721-6 PMID: 21606359

Photo: Green Anemone, New England Aquarium, Boston.

sciseekclaimtoken-4e80c7ad98a90

Can gene therapy eradicate HIV?

When I learned about this, my jaw dropped. It almost felt like the old light bulb joke: is it easier to screw in the bulb or to turn the ladder? It turns out, when it comes to HIV, the question is not so ill-posed.

HIV infects white cells in our blood called T-cells. It captures a receptor on the cell surface called CCR5 (it's a little more complicated than that, more like trying to unlock handcuffs, with multiple pieces that need to fall into place), and once it grabs it, it docks with the cell and infects it. T-cells are part of our immune system and they attack the virus as well. Ever since I started working on HIV, the problem, from my end, has been: how can we elicit T-cells and antibodies able to recognize (and destroy) the virus?

As I have explained in earlier posts, this has been a challenging task.

I've talked extensively about HIV genetic mutations, but, as you know, human genomes carry mutations too. And here's the interesting finding: a mutation called Delta 32 on the CCR5 receptor gene has been identified and linked to a delay in progression to AIDS. In addition, individuals who have both gene copies mutated, are highly resistant to HIV infection [1]. The mutation changes the receptor on the T-cell in a way that the virus is no longer able to dock with it. And if the virus can't dock with the T-cell, it can't infect it. It slips away until the immune system clears it.

So, can we switch the problem around, as in: instead of making T-cells able to recognize the virus, can we make the T-cells unrecognizable to the virus?

As with many scientific queries, the answer is maybe [2]. Sangamo BioSciences, a California based company, has an ongoing Phase ½ and two Phase 1 trials using gene therapy to introduce the mutation in HIV infected patients. The Phase 1 trial at the University of Pennsylvania just recently announced that one of the subjects in the study went off the antiretroviral drugs and, after an initial spike, within days viral loads dropped to undetectable.

The advantage, if this turns into a permanent eradication of the virus, is the possibility of weaning patients off antiretroviral drugs, which have toxic long term effects and can also develop harmful, drug-resistant strains. Right now HIV infected patients have no choice other than life-long therapy.

The flip side is that gene therapy introduces permanent genetic changes and as such, carries risks. There are also numerous caveats (for example, which cells are the best targets), which are thoroughly discussed in [2]. I only have two cautionary comments to add.

My first thought is that gene therapy is an expensive and invasive procedure, and even if it does develop into a successful means to defeat the virus, it will unlikely become available to patients in Sub-Saharan Africa. And two thirds of the people currently living with HIV/AIDS are in Sub-Saharan Africa. This is why a vaccine that is not only able to prevent the infection, but also to protect the immune system in case the infection has already started, still remains the best and most affordable option.

Second: it's not clear to me whether the results are permanent. You see, HIV is a nasty little virus. It can infect a single cell and stay dormant for years. That is, for years you don't see it, until it wakes up again. And when it wakes up, it can be deadlier than before.  

If this "cure" doesn't completely wipe out the virus, the risk of selecting stronger and more resistant strains is real. HIV replicates so rapidly, and with such a high mutation rate, that it might evolve a new strain able to "grab" the defective receptor. And that would mean a new, tougher viral strain to defeat.

[1] Alkhatib G, Combadiere C, Broder CC, Feng Y, Kennedy PE, Murphy PM, & Berger EA (1996). CC CKR5: a RANTES, MIP-1alpha, MIP-1beta receptor as a fusion cofactor for macrophage-tropic HIV-1. Science (New York, N.Y.), 272 (5270), 1955-8 PMID: 8658171

[2] Van Lunzen J, Fehse B, & Hauber J (2011). Gene therapy strategies: can we eradicate HIV? Current HIV/AIDS reports, 8 (2), 78-84 PMID: 21331536

Photo: wind sculpture, Santa Fe, NM.

Thrilling forensics: an interview with award winning author D.P. Lyle

Cardiologist, story consultant, lecturer, award winning author. Whether you are a mystery writer, a forensics enthusiast, or a fan of medical/forensic thrillers, you can't possibly not know him: D.P. Lyle, MD, is the Macavity Award winning and Edgar® Award nominated author of FORENSICS FOR DUMMIES, FORENSICS & FICTION, HOWDUNIT: FORENSICS, the Dub Walker Thrillers STRESS FRACTURE and HOT LIGHTS, COLD STEEL, and the media tie-in novel ROYAL PAINS: FIRST, DO NO HARM based on the hit TV series. His essay on Jules Verne’s THE MYSTERIOUS ISLAND appears in THRILLERS: 100 MUST READS.

He has worked with many novelists and with the writers of popular television shows such as Law & Order, CSI: Miami, Diagnosis Murder, Monk, Judging Amy, Peacemakers, Cold Case, House, Medium, Women’s Murder Club, 1-800-Missing, The Glades, and Pretty Little Liars.

I can't tell you what an honor it is to have Dr. Lyle on my blog today.

EEG: You are an MD and an award winning writer. Did the two -- medicine and writing -- always go hand in hand in your life, or did the MD turn into writer at some point?

DPL: The medicine definitely came first. I knew I was going to medical school before age 10 and in fact knew that I would go into cardiology so that path was pretty well set at a very young age. I never considered anything else.

I grew up in the South where storytelling is a tradition so was exposed to great storytellers my entire life. I always loved to read and had a great respect for books, whether class books or novels, and I always wanted to write but wasn’t sure I could. I often said that when I retired I would write some of the stories that I had in my head and see where it went. But about 15 or so years ago I realized there was no sense in waiting to retire since that was probably going to be a long time. I enjoy what I’m doing. So I asked myself, “If not now, when?” I took a few night classes at the University of California, Irvine and at an organization called The Learning Tree and then joined a couple of writing groups and began writing.

EEG: Your thrillers are fast-paced, gripping, and rich in forensic and medical details. (Right up my alley!) How are your stories born? Do you take inspiration from your practice, from the news, or is it mostly all the research you do in forensics?

DPL: I guess one of the most common questions that writers get asked is where you get your ideas from? The answer is simply everywhere. I’ll see something on the news, or read something in a book, or come across some interesting medical or forensic fact, or something in an idle conversation with a friend will spark an idea. Of course ideas are a dime a dozen. Most don’t have the legs to become a novel, or even a short story.

The initial step is to turn that idea into a What If? What if this or that happened? From there I begin to develop a story idea and invariably several scenes will come to mind. At this point I’ll start making what I call a Plot Point outline. This is simply a list of things that could happen as the story unfolds. After working on this for a while I have a good idea whether this idea is simply another idea or a concept that can grow into 100,000 word story.

Since most of my books are medical and forensic thrillers I definitely call on my medical experience and knowledge as well as the things I’ve learned about forensics over the years. And research for me is constant. I rummage around the web daily, looking for interesting facts and stories and all the other cool things that are out there.

EEG: You've consulted for popular TV shows like Law and Order and Monk, and for many famous writers. Some of the questions have made it into your popular non-fiction books. Mark Twain used to say: “It's no wonder that truth is stranger than fiction. Fiction has to make sense.” Have you ever come across some medical case that was more absurd than anything you've seen through your consultations?

DPL: Truth is definitely stranger than fiction. I’ve seen so many things since I started medical school that it would take hours to go through even a few of them. People do strange things and strange things happen to people.

One example would be when I was an intern doing my emergency room rotation. It was a late Saturday afternoon and the emergency room was actually quiet for a change when we heard gunshots just outside the door on the receiving ramp where the ambulances drive up. It turned out that a father and son had had some differences they wanted to settle and they decided the best way to do it was with a little small arms fire. But they wanted to be near help after it was over so they decided to drive down to the emergency room of the University Hospital and have it out on the receiving ramp. The father was a better shot. The son took three in the chest and one in the abdomen while the father had two in the chest. They both survived and were both treated in the same major trauma room, their stretchers only 15 feet apart. They weren’t angry anymore as they had settled their differences. Go figure.

One afternoon a tall thin elderly black male walked into the emergency room asking for help. The odd thing was that it was the middle of July and he was wearing a long raincoat. When asked what was wrong, he opened the coat to reveal an ice pick buried to the hilt in his chest. The ice pick wavered with each heartbeat. It seems that he and his wife had had an argument, he had hit her, and she had stabbed him with an ice pick. That was about an hour and a half earlier. He had to change buses twice in order to reach the medical center and the entire time he wore the raincoat to cover the ice pick. After evaluating him with x-rays we found that the ice pick was embedded in his aorta so he was taken to the operating room where the ice pick was removed and the hole in his aorta sutured. He did fine.

All physicians have such stories and many of them revolve around happenings in the emergency room. It’s a wild place. Almost anything can happen at any minute.

EEG: Those are amazing stories. Thanks so much, Dr. Lyle, for sharing them with us, and thank you for answering my questions!

Dr. Lyle runs a forensics blog which is an essential resource for any writer, as well as forensic enthusiasts. To find out more about his lectures, consultations, and thrilling books, visit him at www.dplylemd.com.

Is an HIV vaccine finally possible? Unraveling the secrets of broadly neutralizing antibodies

Last month I talked about the daunting challenge that HIV has presented for the past thirty years. HIV is so variable that as soon as the immune system builds a defense against it, the virus comes up with a new variant that allows it to escape. The only way to defeat such an elusive enemy is with immune responses able to recognize a broad range of HIV subtypes and variants. Unfortunately, antibodies with these characteristics are produced by a minority of patients and only years into the infection, failing to prevent progression to AIDS, the disease caused by HIV. The few vaccine trials conducted in the past decade have failed to elicit proper immune responses. 

The surface (envelope) of the virus looks like this:

Those "mushroom-like"structures (a complex of two proteins) on the envelope are the "handles" the virus uses to dock with the target cells. Once the virus has linked the target cell, it injects its RNA inside, and the infection begins. One way antibodies neutralize the virus, is by "capturing" those handles on its surface and thus preventing it to dock with the cells. Imagine putting a plug into a socket--nothing else can go into that socket anymore. The problem is that these "handles" are very well shielded underneath a coat of sugar molecules, which makes them "slippery" (to use another analogy). Furthermore, the virus changes constantly around them, and this variability allows it to dodge the several attempts the antibodies make to grab it. 

But there's hope at the end of the tunnel.

Two studies published in the latest issue of Science [1, 2] present a new class of broadly neutralizing antibodies and describe the mechanism by which they block the virus, thus giving new insight on how to "teach" the immune system to develop this kind of defenses.

The new class of antibodies found in [1, 2] have been isolated from chronically infected patients, and some of them, like VRC01, are able to neutralize a shocking 90% of different HIV isolates. (When I started working on HIV, five years ago, the best neutralizing antibodies would recognize a mere 40% of the isolates.) The amazing bit is that they do so by mocking the very same mechanism the virus uses to dock with target cells.

It took years for these patients to produce these specials antibodies. These findings show that, though slowly, the immune system can develop appropriate responses to defeat the virus. This process is currently too slow to protect from the infection (the antibodies are produced too late), however, by understanding how these antibodies bind to the virus (which is done using deep sequencing and x-ray crystallography), researchers can learn how they have evolved and, eventually, how to elicit them through a vaccine.

REFERENCES:
[1] Wu, X., Zhou, T., Zhu, J., Zhang, B., Georgiev, I., Wang, C., et al. (2011). Focused Evolution of HIV-1 Neutralizing Antibodies Revealed by Structures and Deep Sequencing Science, 333 (6049), 1593-1602 DOI: 10.1126/science.1207532
[2] Scheid, J., Mouquet, H., Ueberheide, B., Diskin, R., Klein, F., Oliveira, T., et al. (2011). Sequence and Structural Convergence of Broad and Potent HIV Antibodies That Mimic CD4 Binding Science, 333 (6049), 1633-1637 DOI: 10.1126/science.1207227

Photo: wind sculpture, Santa Fe, NM. Canon 40D, focal length 85mm, ISO 100, shutter speed 1/100, F-stop 8.0.