How the immune system recognizes danger from non-danger

There are three types of possible relationships between two different organisms: parasitism is when one benefits from the other, but the other is harmed; mutualism is when both benefit from the relationship; and, finally, commensalism is when one organism benefits and the other is neutral (neither harmed or benefitting). There are roughly 10^12 bacteria in our body. These are "commensal" microbes, because they live in our body without harming us. However, our immune system is trained to recognize "self" from "non-self", so a natural question to ask is: how come the immune system doesn't attack the skin and gut microbiota? In the guts especially, how does the immune system know how to distinguish the numerous pathogens we normally ingest through foods from the beneficial microbes that are fundamental in aiding digestion and nutritional assimilation?

It turns out that what the immune system does is far more complex than recognizing self from non-self. It's become a motto of mine, isn't it, how things are always more complicated than we think they are!

"Bacterial associations with their hosts can be beneficial, damaging, or benign, depending on the context and the identity of players. A host determines the balance of non-self elicitors and danger signals to decide when to activate the immune system against pathogenic infection while also maintaining healthy relationships with commensals [1]."

These interactions are mediated through a class of molecules, called "microbe-associated molecular patterns," or MAMPs, that are present in bacteria and are recognized by the host's immune system. Immune models studied in both insects and vertebrates suggest that both MAMP and danger signals are required to trigger a strong immune response, as shown in the figure below [Credit: Science Magazine]:

While both true pathogens and symbiotic microbes present MAMPs molecules, true pathogens also trigger "danger" signals by damaging host cells or secreting molecules that interfere with host biology.

"Studies in insect model systems suggest that the joint presence of both MAMPs and danger signals may be required to launch a true defense response and that insects have mechanisms for disregarding MAMPs presented in the absence of pathological damage to the host."

Interestingly, these findings suggest that rather than being mutually exclusive, MAMPs and danger signals are read together in a combined signal that helps the immune system decide not just whether or not to mount a response, but also the strength of the response itself. This way, the immune system is able to maintain a homeostatic equilibrium in maintaining a healthy level of symbiotic microbes, and also in dosing the strength of immune response.

"Rather than striving to completely eliminate infections, the immune system might manage a persistent infection at a low and nondamaging level. [...] MAMPs indicate the presence of microbes, but if the microbes are doing little or no damage to the host, the cost of immune activity may exceed the benefit of clearing the infection."

Lazzaro, B., & Rolff, J. (2011). Danger, Microbes, and Homeostasis Science, 332 (6025), 43-44 DOI: 10.1126/science.1200486

Bacteria, biodiversity, and allergies.

You may not have heard of gammaproteobacteria, but I'm sure the names salmonella, escherichia coli, pests and cholera do ring a bell. They are all caused by bacteria that belong to the gammaproteobacteria family. Hanski et al. took small skin samples from 118 Finnish adolescents and found a variety of bacteria, the most represented being Actinobacteria, Bacilli, Clostridia, Betaproteobacteria, Alphaproteobacteria, and Gammaproteobacteria.

"Ew," you're probably thinking. Well. . . think again.

On an average human there are an estimated 10^12 bacteria that make their home in the outer layers of our epidermis and in our hair follicles. And yes, you've guessed it: these guys are very much needed. In their study [1], Hanski et al. correlated the lack of biodiversity in skin microbiota with allergic disposition. The study subjects were from different size towns and villages, offering a diverse range of exposure to bacteria. To analyze the skin microbiota, they took DNA samples from the epidermis on the inside of the arm. To test allergy predisposition they measured IgE antibody levels after exposure to a mixture of common inhalant allergens, and used a cutoff point to define atopic individuals (the ones that showed a predisposition toward allergic hypersensitivity). A side note: IgE antibodies are responsible for the over-stimulation of mast cells and basophils that trigger allergic reactions. Atopic individuals can have up to ten times the normal IgE levels, though that doesn't exclude individuals with normal IgE levels from having an allergic reaction.

In order to test their hypothesis, Hanski et al. did a principal component analysis in which they compared the number of bacteria genera found in the skin samples with land use in the immediate surrounding (whether agricultural, , forest, built area, etc. within 3 km of the subject's home).

"The PC1_env of the land use types was significantly (P = 0.0033) related to PC2_bac, indicating that the generic diversity of proteo-bacteria was higher on the skin of individuals living in an environment with more forest and agricultural land compared with those living in built areas and near water bodies."

PC1 and PC2 in the above are the first and second principal components. Next, the researchers repeated a similar principal component analysis to attest the correlation between diversity in skin microbiota and atopy. One thing to ask when carrying this kind of analyses is whether the atopic subjects in the study are evenly distributed across agricultural and urban areas. If the distribution is skewed (for example, if most atopic subjects live in the city and only a few in agricultural areas), this could clearly skew the results. The researchers checked this and found no correlation between atopy and spatial distribution. they also checked for other possible confounders (other factors that might skew the analysis) such as passive smoking and pets, but none were significantly correlated with atopy.

"Atopic individuals had highly significantly (P = 0.0003) lower generic diversity of gammaproteobacteria on the skin compared with healthy individuals."

Furthermore, the researchers found "one significant correlation, between the relative abundance of gammaproteobacteria and IL-10 expression in healthy individuals (P = 0.015)." IL-10 are anti-inflammatory cytokines (protein molecules).

Overall, an interesting paper, as it reinforces the hypothesis that by limiting the exposures to our immune system we are somehow altering our ability to build appropriate responses to the environment. We are indeed seeing a decline in biodiversity of the environment we live in and at the same time witnessing an increasing prevalence of allergies. I do wonder about the number of subjects (118) versus the high number of tests the researchers conducted. And I also wonder whether the researchers tried a logistic regression fit as an alternative to the principal component analysis.

Hanski, I., von Hertzen, L., Fyhrquist, N., Koskinen, K., Torppa, K., Laatikainen, T., Karisola, P., Auvinen, P., Paulin, L., Makela, M., Vartiainen, E., Kosunen, T., Alenius, H., & Haahtela, T. (2012). Environmental biodiversity, human microbiota, and allergy are interrelated Proceedings of the National Academy of Sciences DOI: 10.1073/pnas.1205624109

Hijacking dendritic cells

Dendritic cells are antigen-presenting cells: their main function is to patrol in search for "foreign objects" (the antigens). When it finds an antigen, the dendritic cell "chops it up" in fragments that are then presented to its surface. In more technical terms, it takes up the antigen by either phagocytosis or receptor-mediated endocytosis and transfers it to the cytosol, where further degradation may occur via proteosome. From here the resulting antigen peptides enter the endoplasmic reticulum and, ultimately, are exposed on the cell surface. At this point the dendritic cell migrates to the lymph nodes, which are rich in T-cells. The antigen fragments it carries on its surface are like red flags: once a T-cell recognizes a specific fragment, it gets "activated" and new T-cells with the same antigen specificity are created in order to mount an immune response against the invader.

Now, as you know, HIV infects preferentially T-cells. However, as a sexually transmitted virus, it first enters the body through the genital mucosa. How does the virus find T-cells from there? Easy. It highjacks dendritic cells and takes a ride to the lymph nodes, where the T-cells are.

But wait... the dendritic cell is supposed to kill the virus, not give it a ride...

Unfortunately, HIV has developed a mechanism that allows it to escape the usual degradation process inside the dendritic cell. It is capable of hitchhiking the dendritic cell without compromising its infectivity by residing "in an invaginated domain within the cells that is both contiguous with the plasma membrane and distinct from classical endocytic vesicles [1]." These are small membrane vesicles that are referred to as exosomes. They may be released in the extracellular milieu, following fusion of the multivesicular bodies with the plasma membrane. Once inside the dendritic cell, the virus can infect a T-cell via a mechanism called trans-infection, where the virus is passed from one cell to the other through the release/fusion mechanism of the exosome.

As you can imagine, these mechanisms are very interesting to study because if we could block the "highjacking" of the dendritic cells at the mucosa level, we could possibly stop the virus from spreading to the T-cells and initiate the infection. A team of researchers from Spain and Germany have studied this mechanism extensively. In a 2010 paper [1], Izquierdo-Useros et al. suggested that mature dendritic cell trans-infection could play an important role in augmenting "viral dissemination in the lymphoid tissue and significantly contribute to HIV disease progression." Mature dendritic cell encounter many T-cells every hour, with contacts that last several minutes, and as a consequence they have the potential to infect a broad number of T-cells. This could explain why HIV productive infection is more likely in subjects with a pre-existing sexual infection: the pre-existing mucosal inflammation could be responsible for the mobilization of a higher number of dendritic cells, which, in turn, could favor the spread of the HIV virus.

In a paper published last month [2], the research team showed that a particular class of lipids on the HIV surface favors the uptake of the virus into the dendritic cells. These lipids, called gangliosides, are a group of glycosphingolipids that are comprised of a ceramide linked to several oligosaccharide chains. They are basic components of the host cell’s plasma membrane, and they get incorporated into the viral envelope (the outer shell of the virus) when a new viral particles buds out of the cell. Izquierdo-Useros et al. [2] used artificial virus-like particle to show that only viruses with these lipids present on their surface were able to get into the dendritic cells.

Together, these findings pave new ways for novel strategies to block the spread of the HIV virus in the body, as well as a possible dendritic cell based vaccine.

Edit: As I was browsing the latest PNAS issue, I noticed an independent paper that reports the same finding that glycosphingolipid GM3 on the HIV-1 envelope allows for viral capture by mature dendritic cells. I've included the citation below [3].

[1] Izquierdo-Useros, N., Naranjo-Gómez, M., Erkizia, I., Puertas, M., Borràs, F., Blanco, J., & Martinez-Picado, J. (2010). HIV and Mature Dendritic Cells: Trojan Exosomes Riding the Trojan Horse? PLoS Pathogens, 6 (3) DOI: 10.1371/journal.ppat.1000740

[2] Izquierdo-Useros, N., Lorizate, M., Contreras, F., Rodriguez-Plata, M., Glass, B., Erkizia, I., Prado, J., Casas, J., Fabriàs, G., Kräusslich, H., & Martinez-Picado, J. (2012). Sialyllactose in Viral Membrane Gangliosides Is a Novel Molecular Recognition Pattern for Mature Dendritic Cell Capture of HIV-1 PLoS Biology, 10 (4) DOI: 10.1371/journal.pbio.1001315.

[3] Puryear, W., Yu, X., Ramirez, N., Reinhard, B., & Gummuluru, S. (2012). HIV-1 incorporation of host-cell-derived glycosphingolipid GM3 allows for capture by mature dendritic cells Proceedings of the National Academy of Sciences, 109 (19), 7475-7480 DOI: 10.1073/pnas.1201104109
 

Avian influenza, ferrets, and bioterrorism: fear versus science

I learned about this last week, when Science published a short article on how the National Science Advisory Board for Biosecurity had recommended two research groups NOT to publish details on how avian influenza strains were modified in order to make them transmissible through aerosol in ferrets.

You can read that story here.

The first thing that struck me was: is this censorship? Because for as long as I've been a scientist I've known that the great bulk of scientific progress is made through the free exchange of ideas and results. The very core of scientific validation is in the reproducibility of an experiment, and you can't reproduce an experiment unless who conducted it shares the details.

Why then the recommendation?

The World Health Organization currently lists the case fatality of avian influenza (H5) somewhere between 50% and 80%. This is the percentage of all cases that report in a hospital and have been confirmed through labwork. Currently, it is transmissible through fluids by coming in contact with infected birds. The two studies under the radar here, by Ron Fouchier at Erasmus Medical Center in Rotterdam and by Yoshihiro Kawaoka at the University of Wisconsin, have been submitted but not yet published to Science and Nature respectively. Though different, they both prove that it takes a relatively small number of mutations for the virus to become transmissible through aerosol in ferrets.

Why the fear? With a fatality rate anywhere above 50%, if you can make the virus transmissible through aerosol, you've got a deadly weapon. But is it so obvious one can make it?

First, ferrets are not humans and currently we have no way to predict whether what has been observed in ferrets is likely to happen in humans. For example, there are many strains of avian influenza, and they all have been circulating in birds for many decades. However, of all these strains, only three (H1, H2, and H3) have been able to circulate in humans. There is a natural bottleneck in the way a virus is able to adapt from one organism to another.

One may object we don't know for sure, so, theoretically, it could be possible. But in that case, is censorship the answer? I honestly don't think so and I was quite happy to find a PNAS paper [1] in complete agreement with my thoughts:

"Why Is it Important to Have the Full Data Published? With respect to the specific papers by Fouchier and Kawaoka, it would be important for other scientists to replicate portions of these works to test new vaccines/therapeutic agents and for continued studies on the molecular aspects of influenza transmission, a topic that is extremely important yet relatively poorly understood."

And, most importantly:

"It would be very difficult for a bioterrorist to come up with a human virus strain that is transmissible and still highly virulent. Under natural conditions, however, there is virtually unlimited allowance for generation of capable viruses, the opportunities for infection of humans are plentiful, and the evolutionary pressures of selection are great. If anyone could do it, Nature could."

And that's exactly why we need to be prepared. And the way we are prepared is by sharing results and having multiple groups worldwide brainstorm and join forces to find a vaccine.

What do you guys think?

Palese, P., & Wang, T. (2012). H5N1 influenza viruses: Facts, not fear Proceedings of the National Academy of Sciences, 109 (7), 2211-2213 DOI: 10.1073/pnas.1121297109

The curse of drug-resistant TB strains

Tuberculosis (TB) is a disease caused by a number of strains of mycobacteria. It affects mostly the lungs with chronic, bloody cough and fever. It can remain asymptomatic as a latent infection, though about 10% of these latent infections eventually progress to active disease.

The two most common drugs used to treat TB are isoniazid and rifampicin, but unfortunately new mycobacteria strains (called MDR strains, which stands for multi-drug resistant) have emerged that are resistant to both these powerful drugs. In other words, the pathogens have developed certain mutations that make them "immune" to the drugs. As with HIV, common thought is that these drug-resistant strains emerge during the course of the treatment in single individuals as a result of the selection pressure induced by the drugs. This is also reinforced by the fact that typically drug-resistant mutations confer a cost of fitness: though able to escape the drugs, the mutated strains tend to reproduce less quickly and/or are not able to be transmitted.

Unfortunately, that's not always true. A study published by Nature Genetics in December [1] showed that MDR TB strains do not show a fitness cost and that the most common drug-resistant mutation is present in the population with a wide variety of compensatory mutations. These are additional mutations that compensate for the loss of fitness by working in antagonistic epistasis to lessen the structural and functional instability of the affected proteins.

Comas et al. compared

"the genome sequences of ten paired clinical rifampicin-resistant isolates to the genomes of the corresponding rifampicin-susceptible isolates recovered from the same infected individual at an earlier time point. We identified all nonsynonymous and intergenic mutations found only in the rifampicin-resistant genomes. In addition, we experimentally evolved six laboratory-derived rifampicin-resistant mutants from rifampicin-susceptible ancestors during 45 weeks of serial subculture in the absence of rifampicin."

They showed that

"The high frequency of compensatory mutations in strains from Abkhazia/Georgia, Uzbekistan and Kazakhstan is consistent with the success of MDR strains in these regions, where up to 50% of individuals with TB are estimated to carry MDR strains compared to a global average of only 3%."

These findings are particularly relevant for TB treatment policies: isoniazid and rifampicin have been used not only to treat infected patients, but also as a preventive measure for people visiting countries with high TB prevalence (as for example peace corps). Furthermore, people are treated as soon as they become TB positive, but for the most part these infection are latent and all genetic information we have on TB is from active infections. There's no way to know if these drugs are effective until the infection becomes active. If these MTR strains are not only fit but also transmissible, the persistent use of these drugs will have the net effect of allowing breeding and spreading drug-resistant strains, resulting in a rise of non-treatable infections.

"In conclusion, our results suggest that the acquisition over time of particular mutations in rpoA and rpoC in rifampicin-resistant M. tuberculosis strains leads to the emergence of MDR strains with high fitness. Furthermore, our data show that these mutations occur at high frequencies in clinical settings, particularly in hotspot regions of MDR TB9. Additional studies are needed to determine whether MDR strains of M. tuberculosis with mutations in rpoA or rpoC have increased transmission rates and how these mutations contribute to the success of these strains. Use of targeted genotyping of these mutations will enable TB control programs to focus on the most transmissible MDR strains. Our findings also suggest that mathematical models that aim at predicting the future of the global MDR TB epidemic should take into account the effects of compensatory mutations as well as the time necessary for such mutations to emerge."

[1] Comas, I., Borrell, S., Roetzer, A., Rose, G., Malla, B., Kato-Maeda, M., Galagan, J., Niemann, S., & Gagneux, S. (2011). Whole-genome sequencing of rifampicin-resistant Mycobacterium tuberculosis strains identifies compensatory mutations in RNA polymerase genes Nature Genetics, 44 (1), 106-110 DOI: 10.1038/ng.1038

Photo: making progress with my macro lens! Canon 40D, focal length 100mm, shutter speed 1/100, F-stop 14, ISO speed 100.

A battle for transcription regulates bacterial conjugation

Genetic information is transmitted in two modes: when we talk about the slow accumulation of mutations across generations, we are talking about vertical gene transfer, in other words, the transmission of genetic alleles from the parents to the offsprings. Genetic material can also be transferred "horizontally" when an organism incorporates another individual's genetic material without being the individual's offspring. A genetic chimera is an example of a horizontal gene transfer.

You can picture horizontal gene transfer as a sudden increase in genetic diversity. While most of evolution studies have focused on vertical gene transfers, horizontal gene transfer has been shown in some milestones in the evolution of life: for example mitochondria have originated through a horizontal transfer event from an eukaryotic cell which incorporated a bacteria by symbiosis.

Bacterial conjugation is the horizontal gene transfer process through which bacteria exchange genetic material. That's what makes bacteria so efficient at developing antibiotic resistance. It takes many mutations to find the ones that confer resistance, but once the mutation appears in the population, it spreads to other individuals very quickly. How?

Besides the usual strand of chromosomal DNA, bacteria have a separate DNA molecule called plasmid, which is a short bit of double-stranded, circular DNA (circularity makes it more stable). The plasmid is what gets transferred during bacterial conjugation. The process involves a donor cell and a recipient cell. The donor has the plasmid with the gene that confers antibiotic resistance, and the recipient doesn't. Once the donor "recognizes" that the nearby cell lacks the resistance gene, a channel gets opened from the donor cell to the recipient. One of the two DNA strands in the plasmid is cut, unrolled, and transferred to the donor cell through the channel. Both cells then produce the complementary strand, and the original plasmid is restored in both.

But how does the donor cell know that the nearby cell does not have the resistance gene? Each cell communicates by expressing different peptides and "sensing" the neighbor's peptides through a mechanism called "Type 4 secretion system," or TFSS. Once it "detects" that the neighbor doesn't have the resistant gene, conjugation is activated.

Chatterjee et al. [1] studied the mechanism in Enterococcus faecalis and presented a mathematical model (supported by experimental data) of conjugative transfer regulated through convergent transcription from antagonistic genes, in other words, genes that sit on opposite strands of the DNA and hence compete for transcription.

Two genes on the plasmid regulate conjugation: gene Q activates it, and gene X represses it. Now, here's the interesting bit: X and Q are overlapping, sense-antisense genes. This means that they get transcribed in opposite directions. Remember: transcription is the process that converts DNA into a single strand of RNA, which is what the cell needs in order to produce proteins. Think of the single stranded RNA as a list of instructions that needs to get through. If the RNA from gene Q is produced, then conjugation is activated and the plasmid transfer occurs. If RNA from the X gene is produced instead, conjugation is repressed.

RNA transcription is carried out through an enzyme that "slides" through the DNA much like a zipper. The novel idea of this paper is that if the genes are transcribed in opposite directions, the two enzymes transcribing each gene will "collide" with a certain probability. One enzyme slides in one direction, the other in the opposite direction, and depending on how frequently the process takes place, the two enzymes "crash", interrupting the transcription process, as illustrated in the graphics below (by Kaitlyn Pladson and Ranja Sem).

Each time a collision happens, incomplete strands of complementary RNA are created. Complementary RNA strands will "stick" together and when that happens they can no longer be used to make proteins. As a result, the two enzymes are effectively competing against one another for which of the two genes gets transcribed: where and how frequently they collide regulates the activation of either the gene X or the gene Q, thus initiating or repressing bacterial conjugation. This kind of competition between the two enzymes due to the relative expressions of sense and antisense genes is what regulates the switch between activating the conjugation or repressing it. In the end, the enzyme that is able to zip through the gene faster ultimately "wins" because it is able to produce a larger concentration of RNA strands.

As I read the paper, I couldn't help but wonder how many other biological mechanisms are regulated by this sense-antisense antagonistic transcription. We know there are sense-antisense genes in the human genome, and little is known about their function. This study sheds new light into these DNA regions and advocates for more equivalent research in the human genome. As Chatterjee et al. conclude in their paper, "The fact that convergent transcription is ubiquitous and has persisted in evolution is perhaps an indication that such gene organizations confer fundamental mechanisms of gene regulation. With such a wide range of possible outcomes, using subtle structural tuning, convergent transcription may be highly adaptable to become a robust controller for many complex cellular events."

[1] Chatterjee A, Johnson CM, Shu CC, Kaznessis YN, Ramkrishna D, Dunny GM, & Hu WS (2011). Convergent transcription confers a bistable switch in Enterococcus faecalis conjugation. Proceedings of the National Academy of Sciences of the United States of America, 108 (23), 9721-6 PMID:
21606359

Photo: morning glories. Canon 40D, shutter speed 1/400, focal length 85mm, f-stop 5.6, ISO 100.

A chimeric virus to cure leukemia? Yes, we can!

Last week I talked about gene therapy and vaccines targeting tumor cells. Following those posts, a friend of mine (thanks, Alex!) pointed me to a recent case report published in the New England Journal of Medicine, which describes a successful use of gene therapy to treat leukemia [1]. Since you know I like to talk about chimeric viruses and all the wonderful things you can do with them, I was instantly drawn to the paper.

Leukemia is a type of cancer that causes an abnormal increase in white blood cells. The patient discussed in the NEJM case report was affected by a type of leukemia called B-cell neoplasm, which, as the name indicates, causes the abnormal proliferation of B-cells.

So, how do you address the problem using gene therapy?

This is what we need: (a) a target on the tumor cells that will tell the immune system to destroy them; (b) a weapon for the immune system to recognize and kill the tumor cells; (c) a way to "give" the weapon to the immune system.

The answer to (a) comes from a receptor called CD19, which is expressed by malignant B-cells. The "weapon" (b) is a genetically engineered anti-CD19 antigen receptor, which enables T-cells (our immune system "soldiers") to recognize the malignant B-cells and destroy it. The big question is (c): how do we make T-cells with the anti-CD19 antigen receptor?

This is where gene therapy and chimeric viruses come into play. How do we use gene therapy to transfer the genes that express the anti CD19 antigen receptor into the T-cells? We need "something" that does this for a living -- transfer genes into cells. Remember what that is?

Absolutely, a virus.

Now, remember what virus in particular targets T-cells?

HIV, of course!

And that's exactly what the authors of this study did: they created an HIV chimeric virus and endowed it with the genes of the anti-CD19 antigen receptor. T-cells were collected from the patient, transduced (which means that the genetic material was transferred inside the T-cells using the modified HIV virus), then infused back into the patient.

Like in all best stories, at first things seemed to go terribly wrong: two weeks after the transfusion, the patient started having high fevers; three weeks after treatment the patient had to be hospitalized and treated for metabolic complications consistent with leukemia treatment.

And then the miracle. One month after the infusion there were no more tumor cells in the patient's blood. At the time the paper was written -- ten months after the therapy -- the patient was still in remission, and the antigen recognizing T-cells were still proliferating.

Interestingly, this case report reminds of an almost symmetric case reported in 2008: an HIV-positive patient who developed leukemia was treated with a bone marrow transplant from a donor who had the Delta32 CCR5 mutation I discussed in this post. The mutation modifies T-cells in a way that they can no longer be infected by the HIV virus and, indeed, after the bone marrow transplant, the patient's viral load dropped and never recovered. As far as I know, the patient is the only one ever to be cured of AIDS.

[1] Porter, D., Levine, B., Kalos, M., Bagg, A., & June, C. (2011). Chimeric Antigen Receptor–Modified T Cells in Chronic Lymphoid Leukemia New England Journal of Medicine, 365 (8), 725-733 DOI: 10.1056/NEJMoa1103849

Overlapping genes, nested genes, and antisense genes: how complex can genomes be?

HIV has 10 genes spread throughout roughly 10 thousand nucleotides. The genes Rev and Tat (and Tev, when it’s present), completely overlap with the larger gene Env. When a gene lies within another, we say that the two genes are “nested.”

How does the virus know which protein to code if the information is overlapping? The key is the “reading frame.” Remember, a gene is a string of nucleotides (A, G, C, and T), and a protein is a string of amino acids (also denoted with letters), so it really boils down to translating the string of nucleotides into one made of amino acids. It takes three nucleotides (each triplet is called a "codon") to code one amino acid. So, suppose you have a string of DNA that looks like this (the example is taken from this wonderful site):

ATGCCCAAGCTGAATAGCGTAGAGGGGTTTTCATCATTTGAGGACGATGTATAA

The three nucleotides in green on the left make the five-prime end, where the translation starts, and it can start at any of the three "green" nucleotides. Now, if you begin reading from the A, you get one reading frame, if you begin from the T, you get a second frame, and, lastly, if you begin from the G you get a third one. Like this:

ATG|CCC|AAG|CTG|… becomes MPKL…

  TGC|CCA|AGC|TGA|… becomes CPS…

    GCC|CAA|GCT|GAA|… becomes AQAE…

As you can see, a single strand of DNA can have three possible reading frames because, depending on where you start partitioning the DNA, the triplets change, giving rise to different sequences of amino acids. At this point, you’re probably wondering why go through all this trouble.

Overlapping and nested genes are not uncommon in organisms like virus and bacteria, which have very short genomes (compared to us). For these organisms, a compact genome means a speedier replication process, which is evolutionary advantageous [1].

But how do you explain overlapping genes in more complex organisms like mammals [2]? Our genome is huge compared to that of a virus, and, like I’ve said many times before, it’s mostly non-coding. If there’s plenty of room for extra genes, why do we have overlapping ones?

It gets even more complicated. HIV carries RNA, which is single-stranded, hence, the three reading frames. But we have two strands of DNA, hence six possible reading frames, and some overlapping gene pairs in our genome are indeed transcribed on opposite strands of DNA. These pairs are called sense-antisense gene pairs, and we really don’t know their function. One reason they exist could be that they simply are a remnant of evolution [1]. However, recent studies have shown that these gene pairs may be associated with cancer [3] and diseases such as Alzheimer [4]. In fact, a mutation in the overlapping regions “doubles” its effect in a way, since it affects both genes.

Such associations should not be completely surprising and in fact, I believe they are the tip of some deeper regulatory mechanism that we have yet to understand. If we go back to our very first ancestors, bacteria, we see that these primitive organisms have evolved complex regulatory mechanisms based on sense-antisense genes. These mechanisms have been studied in particular in the context of drug resistance, where it has been shown that this type of “antagonist” transcription has a role in controlling how bacteria exchange genetic material [5], and, as a result facilitate the rise of drug-resistant subspecies. I should explain this phenomenon more in detail in a later post.

[1] Kumar A (2009). An overview of nested genes in eukaryotic genomes. Eukaryotic cell, 8 (9), 1321-9 PMID: 19542305

[2] Sanna CR, Li WH, & Zhang L (2008). Overlapping genes in the human and mouse genomes. BMC genomics, 9 PMID: 18410680

[3] Yu W, Gius D, Onyango P, Muldoon-Jacobs K, Karp J, Feinberg AP, & Cui H (2008). Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature, 451 (7175), 202-6 PMID: 18185590

[4] Guo JH, Cheng HP, Yu L, & Zhao S (2006). Natural antisense transcripts of Alzheimer's disease associated genes. DNA sequence : the journal of DNA sequencing and mapping, 17 (2), 170-3 PMID: 17076261

[5] Chatterjee A, Johnson CM, Shu CC, Kaznessis YN, Ramkrishna D, Dunny GM, & Hu WS (2011). Convergent transcription confers a bistable switch in Enterococcus faecalis conjugation. Proceedings of the National Academy of Sciences of the United States of America, 108 (23), 9721-6 PMID: 21606359

Photo: Green Anemone, New England Aquarium, Boston.

sciseekclaimtoken-4e80c7ad98a90

Can gene therapy eradicate HIV?

When I learned about this, my jaw dropped. It almost felt like the old light bulb joke: is it easier to screw in the bulb or to turn the ladder? It turns out, when it comes to HIV, the question is not so ill-posed.

HIV infects white cells in our blood called T-cells. It captures a receptor on the cell surface called CCR5 (it's a little more complicated than that, more like trying to unlock handcuffs, with multiple pieces that need to fall into place), and once it grabs it, it docks with the cell and infects it. T-cells are part of our immune system and they attack the virus as well. Ever since I started working on HIV, the problem, from my end, has been: how can we elicit T-cells and antibodies able to recognize (and destroy) the virus?

As I have explained in earlier posts, this has been a challenging task.

I've talked extensively about HIV genetic mutations, but, as you know, human genomes carry mutations too. And here's the interesting finding: a mutation called Delta 32 on the CCR5 receptor gene has been identified and linked to a delay in progression to AIDS. In addition, individuals who have both gene copies mutated, are highly resistant to HIV infection [1]. The mutation changes the receptor on the T-cell in a way that the virus is no longer able to dock with it. And if the virus can't dock with the T-cell, it can't infect it. It slips away until the immune system clears it.

So, can we switch the problem around, as in: instead of making T-cells able to recognize the virus, can we make the T-cells unrecognizable to the virus?

As with many scientific queries, the answer is maybe [2]. Sangamo BioSciences, a California based company, has an ongoing Phase ½ and two Phase 1 trials using gene therapy to introduce the mutation in HIV infected patients. The Phase 1 trial at the University of Pennsylvania just recently announced that one of the subjects in the study went off the antiretroviral drugs and, after an initial spike, within days viral loads dropped to undetectable.

The advantage, if this turns into a permanent eradication of the virus, is the possibility of weaning patients off antiretroviral drugs, which have toxic long term effects and can also develop harmful, drug-resistant strains. Right now HIV infected patients have no choice other than life-long therapy.

The flip side is that gene therapy introduces permanent genetic changes and as such, carries risks. There are also numerous caveats (for example, which cells are the best targets), which are thoroughly discussed in [2]. I only have two cautionary comments to add.

My first thought is that gene therapy is an expensive and invasive procedure, and even if it does develop into a successful means to defeat the virus, it will unlikely become available to patients in Sub-Saharan Africa. And two thirds of the people currently living with HIV/AIDS are in Sub-Saharan Africa. This is why a vaccine that is not only able to prevent the infection, but also to protect the immune system in case the infection has already started, still remains the best and most affordable option.

Second: it's not clear to me whether the results are permanent. You see, HIV is a nasty little virus. It can infect a single cell and stay dormant for years. That is, for years you don't see it, until it wakes up again. And when it wakes up, it can be deadlier than before.  

If this "cure" doesn't completely wipe out the virus, the risk of selecting stronger and more resistant strains is real. HIV replicates so rapidly, and with such a high mutation rate, that it might evolve a new strain able to "grab" the defective receptor. And that would mean a new, tougher viral strain to defeat.

[1] Alkhatib G, Combadiere C, Broder CC, Feng Y, Kennedy PE, Murphy PM, & Berger EA (1996). CC CKR5: a RANTES, MIP-1alpha, MIP-1beta receptor as a fusion cofactor for macrophage-tropic HIV-1. Science (New York, N.Y.), 272 (5270), 1955-8 PMID: 8658171

[2] Van Lunzen J, Fehse B, & Hauber J (2011). Gene therapy strategies: can we eradicate HIV? Current HIV/AIDS reports, 8 (2), 78-84 PMID: 21331536

Photo: wind sculpture, Santa Fe, NM.