The fossils hidden in our genome: geneticists turn into archeologists ... sort of.

I often blog about viruses because, well, I work on viruses. Here's a quick summary of things I've blogged about that I find absolutely mind-blowing:

1. About 10% of the human genome is made of genes we inherited from viruses that had replicated in our ancestors millions of years ago.

2. Viruses evolve as their hosts evolve (The Red Queen Effect), and in fact we can retrace their evolution in parallel with that of their hosts. The same is true within a single host, enabling us to retrace the evolution of a single virus in parallel with that of the host's antibodies.

3. Genes expressed by viruses and bacteria in our body can affect our phenotype.

4. We can use the ability of viruses to target certain cells to devise new cancer therapies.

5. We can use viruses to edit the genome of certain cells and cure genetic defects through gene therapy.

So yes, viruses are cool and they play a huge role in evolution. The fact that roughly 10% of our genome is made of viral elements (called human endogenous retroviruses, or HERVs) makes our DNA a "living fossil": these are viruses that infected our ancestors millions of years ago. Retroviruses in particular insert their genome inside the cell's DNA in order to replicate. In some instances, these viral genomes got stuck inside germ line cells and that's how they got passed on to the host's offspring and became part of our DNA.

Today these viruses are extinct, as they evolved into new forms, but by investigating the inactivated genes they left in our genome, researchers can find out what they looked like millions of years ago. It's like digging out fossils in our own cells.

It's exactly what two scientists from The Rockefeller University did with one family of HERVs in particular, HERV-K(HML-2) believed to have replicated in human ancestors less than one million years ago (making it one of the most recent forms found in the human genome). They looked at several of these genes across different subjects and reconstructed a "consensus genome", in other words, a genetic sequence that at each DNA position had the nucleotide most frequently found across all study subjects.

For example, if the samples across all subjects looked something like this, with the differences, highlighted in red (made up sequences!!):

then the consensus sequence would be one of the sequences without red mutations because they represent the majority, in other words:

GATACTTGGACAGGAGTTGAAGCTATAATAAGAATTCTACAACAACTGCT

Back to the HERV study, which was published in PLoS Pathogens in 2007, Lee and Bieniasz recreated the HERV-K consensus from ten full-length HERV-K(HML-2) sequences and then reconstituted the virus in the laboratory. The ten sequences were selected based on their similarity to HERV-K113, a relatively young and intact HERV-K provirus. While all ten sequences had defects that made viral genes inactivated, selecting the most frequent base at each position, eliminated these defects and yielded a full genome sequence (the consensus) with intact proteins. This derived consensus sequence may not be 100% identical to the actual virus that was integrated into the human genome close to a million of years ago, but it's pretty close. This "closeness" was confirmed in the lab when the scientists saw that the virus they reconstructed based on the consensus genome was indeed able to infect T cells in vitro. All proteins of the reconstructed virus were functional and able to carry one the virus's replication cycle.

It's like Jurassic Park... for viruses. :-)

Lee, Y., & Bieniasz, P. (2007). Reconstitution of an Infectious Human Endogenous Retrovirus PLoS Pathogens, 3 (1) DOI: 10.1371/journal.ppat.0030010

Starting the year with some new composites

Last year I only made one composite. That doesn't mean that I wasn't busy doing other stuff, but somehow the thought nagged me. Then last September I had a show at our local gallery with my old composites and the outpour of love and appreciation got me going again. So my new year's resolution is to make more composites.

Here's my first 2016 series, titled The Lady and the Lamp. Enjoy!

As always, prints can be purchased here or here.

The Land of Enchantment

Some of my latest shots, all taken within a few miles from where I live. yes, I'm a lucky gal. Can you guess which ones are sunsets and which sunrises?

As always, prints can be purchased here or here.

The 2015 Dietary Guidelines for Americans are here. And Americans should read them.

Rigatoni pomodorini e tonno. 

Today the FDA released the updated Dietary Recommendations for the USA. The whole document is available on the Internet for free, and you should read it:
http://health.gov/dietaryguidelines/2015/guidelines/

People are going to hate me for this post, but I'm going to post it anyway because somebody needs to say it. When I open Facebook, half of the posts are about how women should love their bodies. What gets me is that nobody says that loving your body is not only about accepting the way you look. Overweight is not healthy. You are not loving your body unless you adopt a healthy lifestyle.

From the guidelines released today:

"In addition, the eating patterns of many are too high in calories. Calorie intake over time, in comparison to calorie needs, is best evaluated by measuring body weight status. The high percentage of the population that is overweight or obese suggests that many in the United States overconsume calories. As documented in the Introduction, Table I-1, more than two-thirds of all adults and nearly one-third of all children and youth in the United States are either overweight or obese."

I look around and I don't see a healthy society. What's even more saddening is that I see young people getting more and more overweight. This is particularly bad because the way the body stores fat is something that is shaped during childhood. Epigenetic marks that regulate the usage and storage of nutrients are set during childhood and are highly affected by the diet. So, a diet high in fats will make a person prone to diabetes and all sorts of health problems.

But this is epigenetics, not genetics. This means that these marks are reversible if you catch them in time. On the other hand, if you don't do anything about it, these epigenetic marks will be passed on to your children and, chances are, to your children's children. In fact, I believe that many of the overweight kids we see today have inherited the marks from their parents. Coupled with an unhealthy lifestyle acquired from home, you have a recipe for disaster: more health bills and a lifetime dependency on medications and their side effects.

America, is this where you want to go?

I grew up on a Mediterranean diet and I never had to go on a weight loss diet in my life. Contrary to what you've been told, carbs are not bad for your health unless you have diabetes or an allergy to gluten. And on a side note, the growing rate of allergies is again the biproduct of unhealthy life styles. And let's face it: anything will make you fat when overconsumed. The key to health is balance. 

The Mediterranean diet is one of the easiest to adopt and it's scientifically proven to provide long-term health benefits [2,3]. Below you can find two of the many papers on how adherence to the Mediterranean diet was found to lower the risk for certain cancers and circulatory diseases. You can find many more on Pubmed. 

Pasta makes for fast and easy recipes, and you can add proteins and vegetables for a complete meal. I shared some recipes here. The image above is another super easy one: Rigatoni Pomodorini e Tonno. All you need is a box of pasta, a can of tuna fillets (I prefer the ones that come in a glass jar, they are a bit more expensive, but the taste and quality are way better), a small container of fresh cherry tomatoes, olive oil, and oregano. 

Half the cherry tomatoes and sauteed them in two tablespoons of olive oil for a few minutes. Add the tune fillets, salt, pepper and oregano, and let simmer for a few minutes. Cook the pasta al dente, drain it and toss it in the pan. Mix well and serve. Voila', a healthy meal is served. :-)

[1] U.S. Department of Health and Human Services and the U.S. Department of Agriculture (2015). Dietary Guidelines for Americans 2015-2020, Eigth Edition health.org DOI: 10.1037/e516742014-001

[2] Mancini, J., Filion, K., Atallah, R., & Eisenberg, M. (2015). Systematic Review of the Mediterranean Diet for Long-Term Weight Loss The American Journal of Medicine DOI: 10.1016/j.amjmed.2015.11.028

[3] Schwingshackl L, & Hoffmann G (2015). Adherence to Mediterranean diet and risk of cancer: an updated systematic review and meta-analysis of observational studies. Cancer medicine PMID: 26471010

Happy New Year and happy first USWG post of the year

This is a monthly event started by the awesome Alex J. Cavanaugh and organized by the Insecure Writer's Support Group. Click here to find out more about the group and sign up for the next event.

Happy New Year everyone! This first ISWG post celebrates the winners of the IWSG Anthology Contest. If you haven't done so, visit Alex J. Cavanaugh's blog to find out who the winners are. Many thanks to this month's co-hosts: L.G. Keltner, Denise Covey, Sheri Larsen, J.Q. Rose, Chemist Ken, Michelle Wallace.

I hope everyone had a wonderful holiday break. Did you take the time to make an assessment of the past year and new writing resolutions for the new year? My 2015 wasn't too bad -- I did publish 3 books after all -- but I confess that I'm much happier with my photographic accomplishments of the past 12 months than the writing ones. Which is sort of ironic, because I expected the year to go in the opposite direction. Oh well, so long as there is some progress I shouldn't be complaining, right? :-)

My new year resolution is to not to be afraid to take my time. If a story needs more time, then be it. Sometimes characters need to simmer for a little a while before their true personality can come out, right?

What about you, what are your new year resolutions in terms of writing and publishing?

Riso, Patate e Cozze

Happy New Year. On new year's eve we usually make a typical dish from Puglia, a region in Southern Italy, and since the recipe involves several steps, this year I decided to document every step with my camera. The result? A photorecipe that I'm sharing here in case you want to try it too. So here it goes: Riso, Patate e Cozze (Rice, Potatoes and Mussels).

Ingredients: potatoes (peeled and sliced), 1 yellow onion, basil, parsley, parmesan, garlic (chopped), grated parmesan, bread crumbs, 1 can of crushed peeled tomatoes, parboiled rice, salt, pepper, extra virgin olive oil.

And mussels, of course, boiled, opened, and halved. If fresh aren't available, you can use the precooked ones you find in the frozen seafood aisle.

Layer mussels at the bottom of a pan, add chopped onion and garlic, parsley, basil, salt and pepper.

Generously sprinkle with parmesan.

Layer potatoes slices.

Add pepper, salt, onion, garlic, parsley, and basil.

Sprinkle with parmesan again.

Add parboiled rice (the kind of rice is very important, has to be parboiled).

Spread the rice evenly on top of the potatoes.

Sprinkle with parmesan and add, once again, salt, pepper, parsley, onion, garlic, and basil.

Spoon the crushed peeled tomatoes and spread over the layer of rice.

Spoon the crushed peeled tomatoes and spread over the layer of rice.

Sprinkle with parmesan.

Add another layer of potato slices.

Sprinkle with salt, pepper, onions, garlic, parsley, and basil.

More parmesan.

Lots of extra virgin olive oil.

Last layer: bread crumbs, evenly distributed on top.

Now add water: we used the tomato can, just fill it with water and then pour it into the pan from one corner so not to disassemble the layers. Pour until the rice is completely covered.

Bake for 1 hour at 350.

Enjoy!