Deep sequencing and forensic science: how to improve DNA fingerprinting

(In case you missed it, this originally appeared last Thursday as a guest blog on the Writer's Forensics Blog.)

There are roughly three billion pairs of nucleotides in human DNA, and the vast majority is identical across individuals. When we talk about “genetic fingerprinting,” we really mean, “looking for a needle in a hay stack.” Luckily, for the most part, we all differ at the same loci. Over the years, the techniques used for DNA typing have improved greatly, diminishing both costs and the likelihood of errors. These days, most forensic laboratories use commercial kits to type specific regions of the DNA that are known to vary across the population. Here in the US, the standard for DNA fingerprinting is to type 13 loci called short tandem repeats (STRs), regions that are 4 or 5 nucleotides long. The likelihood of two individuals having all 13 loci identical is so low that we can deem it virtually impossible (with the exception of identical twins, of course).

Using PCR-based technology (which creates many clone sequences out of a small sample), the commercial kits can rapidly determine the 13 STR alleles even from old, partly degraded DNA. These alleles are then run through CODIS, the DNA database maintained by the FBI, and if the genetic profile is already in the system, a match can be determined.

However, there’s a catch, and it’s called microvariant. From time to time, an individual will have a mutation that is so uncommon it’s never been observed before. The commercial kits are made to recognize specific variants that have already been documented, so when the DNA with the rare mutation is analyzed, the kit will not be able to recognize it. This can potentially lead to mislabeling.

How can we buld a reliable library of STR alleles that faithfully represents the whole population? Until a few years ago, the two sequencing methods available — the chain-termination method (Sanger et al., 1975), and pyrosequencing (Ronaghi et al., 1996) — yielded tens of sequences at the time. The breakthrough came in 2005, when 454 Life Sciences, a biotechnology company based in Branford, CT, invented a new fiber-optic chip that allowed the typing of tens of thousands of DNA sequences [1]. The new method is called 454 sequencing or ultra-deep sequencing.

For those of us working in HIV research, this was a breakthrough. Since we had already shown that only a handful of viruses are transferred during a sexual transmission, deep sequencing allowed us to type the genome of those transmitted viruses, shedding new light on vaccine design.

But what about forensic analyses?

Researchers from Denmark used deep sequencing to analyze five STR loci and found rare base mutations and repeat variations that would have not been found using conventional methods [2]. As mentioned before, in order to reduce typing errors, it’s important to find these variants and incorporate them in the commercially available typing kits. Here in the US, a similar analysis is ongoing at the Forensic Science Program of the Western Carolina University. The goal of the study, led by Professor Mark Wilson, is to understand how deep sequencing can uncover minor variants and hence minimize the rate of inconclusive results from genetic fingerprinting analyses.

In conclusion, just like its name implies, deep sequencing can give us a new depth to DNA sequencing, unveiling new, previously unknown alleles in the population.

[1] Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature, 437 (7057), 376-80 PMID: 16056220

[2] Fordyce SL, Ávila-Arcos MC, Rockenbauer E, Børsting C, Frank-Hansen R, Petersen FT, Willerslev E, Hansen AJ, Morling N, & Gilbert MT (2011). High-throughput sequencing of core STR loci for forensic genetic investigations using the Roche Genome Sequencer FLX platform. BioTechniques, 51 (2), 127-33 PMID: 21806557

Photo: red glass in iron cast. Focal length 85mm, shutter speed 1/50, F-stop 5.6, ISO 100. I know, it's a weird picture... It vaguely reminded me of a jumbled fiber-optic chip... very vaguely, though...

The power of healing: Carol Cassella on being a best selling author, a mom, and an "invisible doctor"

If writing were like painting, Carol Cassella's prose would be an Edward Burne-Jones: luminous, reflective, and perfect even in the smallest details. Dr. Cassella is an anesthesiologist, a novelist, and (the most impressive task, in my opinion!) the mother of two sets of twins. Her first novel, the national bestseller Oxygen, was an Indie Best Pick for July 2008, and selected as one of the best first novels of 2008 by The Library Journal. Her books portray the humanity behind the world of medicine, where healing has to overcome ambition, greed, and weaknesses.

It is my great pleasure and honor to have Dr. Cassella as a guest on my blog today!

EEG: You worked for a while in publishing, before deciding to go back to school and study medicine. Looking back, how important was this decision in becoming the accomplished writer you are today?

CWC: I worked in publishing after graduating from college solely because I loved books and wanted to work around them and among the people who created them. I had harbored dreams of being a writer from the time I learned to read, and stumbling into a job with a publisher was the closest approximation I could find that actually paid my rent. Only problem was, the job I had was selling textbooks for an academic publisher--pretty far cry from my own goals. But I think it was a first step toward realizing that books are not spun in a vacuum. They are the product of many minds and many hands and there is a very concrete business model that underlies their production and distribution. That lesson has certainly stuck with me and helped me navigate some of the mysteries of being a published author. I do wish, though, that I had continued writing fiction more consistently from my childhood. Think how many more words I would have under my belt by now?

EEG: Oh, but books aren't made of just words, as I'm sure you already know! Even when you're not writing, you're experiencing the world as a writer...

I've read many novels about surgeons, medical examiners, ER doctors. Oxygen was the first book I read where the protagonist is an anesthesiologist, and I loved it: it gave me all these insights into a field I knew so little about. I'm curious: of all medical fields, what made you choose anesthesiology?

CWC: I have been an anesthesiologist working in a major hospital's operating rooms for more than fifteen years now, and I still find that work fascinating and uniquely challenging. Even after medical school I didn't fully appreciate all that an anesthesiologist does for their patient. In fact, I became an internist and worked in both public and private clinics for three years before I returned for three more years of training in anesthesia. We are "invisible doctors" in a way--we are usually assigned to our patients on the day of surgery, rather than being chosen by our patients in advance. We talk to our patients for only a few moments before they are sedated or asleep, so they often have no idea of all that we do for them while their surgery takes place. The trust and vulnerability of that role is mind boggling, when you really think about it. And most of us require anesthesia at some point in life; the average American has seven surgeries before they die. I chose the field because I wanted to focus on one patient at a time, which is impossible in most specialties. I love the procedures involved in anesthesia--it is a very tactile field that requires both intellectual decisions and precise manual dexterity for placing nerve blocks, epidurals, intubations, etc. There is also the benefit that I could have a little more control over my hours and with a young family that makes the combination of medicine and mothering more practical. I could work part time as an internist, but only by sharing my patients with another physician, who might not know them as well.

EEG: In your last book, Healer, your protagonists find wealth and comfort through a break-through blood test and then, just as easily, they lose everything. This dichotomy in medicine -- the moral need to heal versus the profit aspect -- is a topic I'm particularly sensitive to. My research is in HIV and vaccine development, and because of that I see with my own eyes the costs of vaccine research while trying to reach out to the poorest parts of the world, where HIV has the highest prevalence. Tell us about your new book, Healer, and what inspired you to write it.

CWC: Ooh. You are touching on a subject close to my heart. For several years I wrote articles for the Bill & Melinda Gates Foundation about vaccine trials and disease prevention in the developing world, and I know quite well the disparities that exist in health care. It is a conundrum--drug and vaccine development is phenomenally expensive and poor countries can't afford it. But those industries are also phenomenally profitable and invest mightily in lobbying our own congress. How do we incentivize medical breakthroughs but also realize the moral, equal distribution of those discoveries? And, of course, we face the same dilemmas here in the United States. We have very unequal access to care. In Healer I was also quite interested in wealth acquired by any means, and how it affects our view of ourselves, our rights, our relationships, and our expectations. In some ways I saw the story as a parable for what our country experienced in the nineties--money that flowed in too easily, seemingly unlimited loans with loose fiscal reins. And here we are. Redefining what is normal!

EEG: I hear you. And with the current budget cuts things are as hard as ever. My boss has a beautiful photo of two African children in her office. They are smiling and playing and you would never guess they are AIDS orphans. When I'm having a bad day at work I look at that photo. It puts things back in perspective.

Carol, thanks so much for taking the time to answer my questions! And thank you for being an advocate for these issues and raising awareness on the costs and struggles of medical research. Your books are amazing and I truly look forward to your next novel.

Dr. Cassella currently practices anesthesia in Seattle and has been a freelance medical writer specializing in global public health advocacy for the developing world. Her new novel, Healer, was released last June. Visit her website to find out more about her books and her public lectures.

The two ends of the spectrum

E.L. Doctorow said: "Writing is a socially acceptable form of schizophrenia."

Then, by analogy, scientific research must be a socially acceptable form of autism.

Photo: Sculpture by Susan Stamm Evans, Santa Fe, NM. Focal length 38mm, F-stop 9, shutter speed 1/50, ISO 100. What I love most about this sculpture is that you can tell without any doubt that they are a man and a woman, and yet, if you look closely, the differences are so subtle. Chin, nose, and proportions. Wow!

Like watercolors

Picture: dry storm at sunset. Canon 40D, focal length 17mm, exposure time 1/25.

Overlapping genes, nested genes, and antisense genes: how complex can genomes be?

HIV has 10 genes spread throughout roughly 10 thousand nucleotides. The genes Rev and Tat (and Tev, when it’s present), completely overlap with the larger gene Env. When a gene lies within another, we say that the two genes are “nested.”

How does the virus know which protein to code if the information is overlapping? The key is the “reading frame.” Remember, a gene is a string of nucleotides (A, G, C, and T), and a protein is a string of amino acids (also denoted with letters), so it really boils down to translating the string of nucleotides into one made of amino acids. It takes three nucleotides (each triplet is called a "codon") to code one amino acid. So, suppose you have a string of DNA that looks like this (the example is taken from this wonderful site):

ATGCCCAAGCTGAATAGCGTAGAGGGGTTTTCATCATTTGAGGACGATGTATAA

The three nucleotides in green on the left make the five-prime end, where the translation starts, and it can start at any of the three "green" nucleotides. Now, if you begin reading from the A, you get one reading frame, if you begin from the T, you get a second frame, and, lastly, if you begin from the G you get a third one. Like this:

ATG|CCC|AAG|CTG|… becomes MPKL…

  TGC|CCA|AGC|TGA|… becomes CPS…

    GCC|CAA|GCT|GAA|… becomes AQAE…

As you can see, a single strand of DNA can have three possible reading frames because, depending on where you start partitioning the DNA, the triplets change, giving rise to different sequences of amino acids. At this point, you’re probably wondering why go through all this trouble.

Overlapping and nested genes are not uncommon in organisms like virus and bacteria, which have very short genomes (compared to us). For these organisms, a compact genome means a speedier replication process, which is evolutionary advantageous [1].

But how do you explain overlapping genes in more complex organisms like mammals [2]? Our genome is huge compared to that of a virus, and, like I’ve said many times before, it’s mostly non-coding. If there’s plenty of room for extra genes, why do we have overlapping ones?

It gets even more complicated. HIV carries RNA, which is single-stranded, hence, the three reading frames. But we have two strands of DNA, hence six possible reading frames, and some overlapping gene pairs in our genome are indeed transcribed on opposite strands of DNA. These pairs are called sense-antisense gene pairs, and we really don’t know their function. One reason they exist could be that they simply are a remnant of evolution [1]. However, recent studies have shown that these gene pairs may be associated with cancer [3] and diseases such as Alzheimer [4]. In fact, a mutation in the overlapping regions “doubles” its effect in a way, since it affects both genes.

Such associations should not be completely surprising and in fact, I believe they are the tip of some deeper regulatory mechanism that we have yet to understand. If we go back to our very first ancestors, bacteria, we see that these primitive organisms have evolved complex regulatory mechanisms based on sense-antisense genes. These mechanisms have been studied in particular in the context of drug resistance, where it has been shown that this type of “antagonist” transcription has a role in controlling how bacteria exchange genetic material [5], and, as a result facilitate the rise of drug-resistant subspecies. I should explain this phenomenon more in detail in a later post.

[1] Kumar A (2009). An overview of nested genes in eukaryotic genomes. Eukaryotic cell, 8 (9), 1321-9 PMID: 19542305

[2] Sanna CR, Li WH, & Zhang L (2008). Overlapping genes in the human and mouse genomes. BMC genomics, 9 PMID: 18410680

[3] Yu W, Gius D, Onyango P, Muldoon-Jacobs K, Karp J, Feinberg AP, & Cui H (2008). Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature, 451 (7175), 202-6 PMID: 18185590

[4] Guo JH, Cheng HP, Yu L, & Zhao S (2006). Natural antisense transcripts of Alzheimer's disease associated genes. DNA sequence : the journal of DNA sequencing and mapping, 17 (2), 170-3 PMID: 17076261

[5] Chatterjee A, Johnson CM, Shu CC, Kaznessis YN, Ramkrishna D, Dunny GM, & Hu WS (2011). Convergent transcription confers a bistable switch in Enterococcus faecalis conjugation. Proceedings of the National Academy of Sciences of the United States of America, 108 (23), 9721-6 PMID: 21606359

Photo: Green Anemone, New England Aquarium, Boston.

sciseekclaimtoken-4e80c7ad98a90

Can gene therapy eradicate HIV?

When I learned about this, my jaw dropped. It almost felt like the old light bulb joke: is it easier to screw in the bulb or to turn the ladder? It turns out, when it comes to HIV, the question is not so ill-posed.

HIV infects white cells in our blood called T-cells. It captures a receptor on the cell surface called CCR5 (it's a little more complicated than that, more like trying to unlock handcuffs, with multiple pieces that need to fall into place), and once it grabs it, it docks with the cell and infects it. T-cells are part of our immune system and they attack the virus as well. Ever since I started working on HIV, the problem, from my end, has been: how can we elicit T-cells and antibodies able to recognize (and destroy) the virus?

As I have explained in earlier posts, this has been a challenging task.

I've talked extensively about HIV genetic mutations, but, as you know, human genomes carry mutations too. And here's the interesting finding: a mutation called Delta 32 on the CCR5 receptor gene has been identified and linked to a delay in progression to AIDS. In addition, individuals who have both gene copies mutated, are highly resistant to HIV infection [1]. The mutation changes the receptor on the T-cell in a way that the virus is no longer able to dock with it. And if the virus can't dock with the T-cell, it can't infect it. It slips away until the immune system clears it.

So, can we switch the problem around, as in: instead of making T-cells able to recognize the virus, can we make the T-cells unrecognizable to the virus?

As with many scientific queries, the answer is maybe [2]. Sangamo BioSciences, a California based company, has an ongoing Phase ½ and two Phase 1 trials using gene therapy to introduce the mutation in HIV infected patients. The Phase 1 trial at the University of Pennsylvania just recently announced that one of the subjects in the study went off the antiretroviral drugs and, after an initial spike, within days viral loads dropped to undetectable.

The advantage, if this turns into a permanent eradication of the virus, is the possibility of weaning patients off antiretroviral drugs, which have toxic long term effects and can also develop harmful, drug-resistant strains. Right now HIV infected patients have no choice other than life-long therapy.

The flip side is that gene therapy introduces permanent genetic changes and as such, carries risks. There are also numerous caveats (for example, which cells are the best targets), which are thoroughly discussed in [2]. I only have two cautionary comments to add.

My first thought is that gene therapy is an expensive and invasive procedure, and even if it does develop into a successful means to defeat the virus, it will unlikely become available to patients in Sub-Saharan Africa. And two thirds of the people currently living with HIV/AIDS are in Sub-Saharan Africa. This is why a vaccine that is not only able to prevent the infection, but also to protect the immune system in case the infection has already started, still remains the best and most affordable option.

Second: it's not clear to me whether the results are permanent. You see, HIV is a nasty little virus. It can infect a single cell and stay dormant for years. That is, for years you don't see it, until it wakes up again. And when it wakes up, it can be deadlier than before.  

If this "cure" doesn't completely wipe out the virus, the risk of selecting stronger and more resistant strains is real. HIV replicates so rapidly, and with such a high mutation rate, that it might evolve a new strain able to "grab" the defective receptor. And that would mean a new, tougher viral strain to defeat.

[1] Alkhatib G, Combadiere C, Broder CC, Feng Y, Kennedy PE, Murphy PM, & Berger EA (1996). CC CKR5: a RANTES, MIP-1alpha, MIP-1beta receptor as a fusion cofactor for macrophage-tropic HIV-1. Science (New York, N.Y.), 272 (5270), 1955-8 PMID: 8658171

[2] Van Lunzen J, Fehse B, & Hauber J (2011). Gene therapy strategies: can we eradicate HIV? Current HIV/AIDS reports, 8 (2), 78-84 PMID: 21331536

Photo: wind sculpture, Santa Fe, NM.

Thrilling forensics: an interview with award winning author D.P. Lyle

Cardiologist, story consultant, lecturer, award winning author. Whether you are a mystery writer, a forensics enthusiast, or a fan of medical/forensic thrillers, you can't possibly not know him: D.P. Lyle, MD, is the Macavity Award winning and Edgar® Award nominated author of FORENSICS FOR DUMMIES, FORENSICS & FICTION, HOWDUNIT: FORENSICS, the Dub Walker Thrillers STRESS FRACTURE and HOT LIGHTS, COLD STEEL, and the media tie-in novel ROYAL PAINS: FIRST, DO NO HARM based on the hit TV series. His essay on Jules Verne’s THE MYSTERIOUS ISLAND appears in THRILLERS: 100 MUST READS.

He has worked with many novelists and with the writers of popular television shows such as Law & Order, CSI: Miami, Diagnosis Murder, Monk, Judging Amy, Peacemakers, Cold Case, House, Medium, Women’s Murder Club, 1-800-Missing, The Glades, and Pretty Little Liars.

I can't tell you what an honor it is to have Dr. Lyle on my blog today.

EEG: You are an MD and an award winning writer. Did the two -- medicine and writing -- always go hand in hand in your life, or did the MD turn into writer at some point?

DPL: The medicine definitely came first. I knew I was going to medical school before age 10 and in fact knew that I would go into cardiology so that path was pretty well set at a very young age. I never considered anything else.

I grew up in the South where storytelling is a tradition so was exposed to great storytellers my entire life. I always loved to read and had a great respect for books, whether class books or novels, and I always wanted to write but wasn’t sure I could. I often said that when I retired I would write some of the stories that I had in my head and see where it went. But about 15 or so years ago I realized there was no sense in waiting to retire since that was probably going to be a long time. I enjoy what I’m doing. So I asked myself, “If not now, when?” I took a few night classes at the University of California, Irvine and at an organization called The Learning Tree and then joined a couple of writing groups and began writing.

EEG: Your thrillers are fast-paced, gripping, and rich in forensic and medical details. (Right up my alley!) How are your stories born? Do you take inspiration from your practice, from the news, or is it mostly all the research you do in forensics?

DPL: I guess one of the most common questions that writers get asked is where you get your ideas from? The answer is simply everywhere. I’ll see something on the news, or read something in a book, or come across some interesting medical or forensic fact, or something in an idle conversation with a friend will spark an idea. Of course ideas are a dime a dozen. Most don’t have the legs to become a novel, or even a short story.

The initial step is to turn that idea into a What If? What if this or that happened? From there I begin to develop a story idea and invariably several scenes will come to mind. At this point I’ll start making what I call a Plot Point outline. This is simply a list of things that could happen as the story unfolds. After working on this for a while I have a good idea whether this idea is simply another idea or a concept that can grow into 100,000 word story.

Since most of my books are medical and forensic thrillers I definitely call on my medical experience and knowledge as well as the things I’ve learned about forensics over the years. And research for me is constant. I rummage around the web daily, looking for interesting facts and stories and all the other cool things that are out there.

EEG: You've consulted for popular TV shows like Law and Order and Monk, and for many famous writers. Some of the questions have made it into your popular non-fiction books. Mark Twain used to say: “It's no wonder that truth is stranger than fiction. Fiction has to make sense.” Have you ever come across some medical case that was more absurd than anything you've seen through your consultations?

DPL: Truth is definitely stranger than fiction. I’ve seen so many things since I started medical school that it would take hours to go through even a few of them. People do strange things and strange things happen to people.

One example would be when I was an intern doing my emergency room rotation. It was a late Saturday afternoon and the emergency room was actually quiet for a change when we heard gunshots just outside the door on the receiving ramp where the ambulances drive up. It turned out that a father and son had had some differences they wanted to settle and they decided the best way to do it was with a little small arms fire. But they wanted to be near help after it was over so they decided to drive down to the emergency room of the University Hospital and have it out on the receiving ramp. The father was a better shot. The son took three in the chest and one in the abdomen while the father had two in the chest. They both survived and were both treated in the same major trauma room, their stretchers only 15 feet apart. They weren’t angry anymore as they had settled their differences. Go figure.

One afternoon a tall thin elderly black male walked into the emergency room asking for help. The odd thing was that it was the middle of July and he was wearing a long raincoat. When asked what was wrong, he opened the coat to reveal an ice pick buried to the hilt in his chest. The ice pick wavered with each heartbeat. It seems that he and his wife had had an argument, he had hit her, and she had stabbed him with an ice pick. That was about an hour and a half earlier. He had to change buses twice in order to reach the medical center and the entire time he wore the raincoat to cover the ice pick. After evaluating him with x-rays we found that the ice pick was embedded in his aorta so he was taken to the operating room where the ice pick was removed and the hole in his aorta sutured. He did fine.

All physicians have such stories and many of them revolve around happenings in the emergency room. It’s a wild place. Almost anything can happen at any minute.

EEG: Those are amazing stories. Thanks so much, Dr. Lyle, for sharing them with us, and thank you for answering my questions!

Dr. Lyle runs a forensics blog which is an essential resource for any writer, as well as forensic enthusiasts. To find out more about his lectures, consultations, and thrilling books, visit him at www.dplylemd.com.

Is an HIV vaccine finally possible? Unraveling the secrets of broadly neutralizing antibodies

Last month I talked about the daunting challenge that HIV has presented for the past thirty years. HIV is so variable that as soon as the immune system builds a defense against it, the virus comes up with a new variant that allows it to escape. The only way to defeat such an elusive enemy is with immune responses able to recognize a broad range of HIV subtypes and variants. Unfortunately, antibodies with these characteristics are produced by a minority of patients and only years into the infection, failing to prevent progression to AIDS, the disease caused by HIV. The few vaccine trials conducted in the past decade have failed to elicit proper immune responses. 

The surface (envelope) of the virus looks like this:

Those "mushroom-like"structures (a complex of two proteins) on the envelope are the "handles" the virus uses to dock with the target cells. Once the virus has linked the target cell, it injects its RNA inside, and the infection begins. One way antibodies neutralize the virus, is by "capturing" those handles on its surface and thus preventing it to dock with the cells. Imagine putting a plug into a socket--nothing else can go into that socket anymore. The problem is that these "handles" are very well shielded underneath a coat of sugar molecules, which makes them "slippery" (to use another analogy). Furthermore, the virus changes constantly around them, and this variability allows it to dodge the several attempts the antibodies make to grab it. 

But there's hope at the end of the tunnel.

Two studies published in the latest issue of Science [1, 2] present a new class of broadly neutralizing antibodies and describe the mechanism by which they block the virus, thus giving new insight on how to "teach" the immune system to develop this kind of defenses.

The new class of antibodies found in [1, 2] have been isolated from chronically infected patients, and some of them, like VRC01, are able to neutralize a shocking 90% of different HIV isolates. (When I started working on HIV, five years ago, the best neutralizing antibodies would recognize a mere 40% of the isolates.) The amazing bit is that they do so by mocking the very same mechanism the virus uses to dock with target cells.

It took years for these patients to produce these specials antibodies. These findings show that, though slowly, the immune system can develop appropriate responses to defeat the virus. This process is currently too slow to protect from the infection (the antibodies are produced too late), however, by understanding how these antibodies bind to the virus (which is done using deep sequencing and x-ray crystallography), researchers can learn how they have evolved and, eventually, how to elicit them through a vaccine.

REFERENCES:
[1] Wu, X., Zhou, T., Zhu, J., Zhang, B., Georgiev, I., Wang, C., et al. (2011). Focused Evolution of HIV-1 Neutralizing Antibodies Revealed by Structures and Deep Sequencing Science, 333 (6049), 1593-1602 DOI: 10.1126/science.1207532
[2] Scheid, J., Mouquet, H., Ueberheide, B., Diskin, R., Klein, F., Oliveira, T., et al. (2011). Sequence and Structural Convergence of Broad and Potent HIV Antibodies That Mimic CD4 Binding Science, 333 (6049), 1633-1637 DOI: 10.1126/science.1207227

Photo: wind sculpture, Santa Fe, NM. Canon 40D, focal length 85mm, ISO 100, shutter speed 1/100, F-stop 8.0.

Only at 7,000 feet...

I miss the ocean. I really do. But you can't beat skies like this.

Photos: dawn, dawn, and sunset. The mountains in the photo in the middle are the Sangre de Cristo.

Aww...

So cute. Makes me wanna deliver their mail.

Photo: blue bicycle mailbox. Canon 40D, focal length 70mm, shutter speed 1/100.

All you need is love... and the right alleles

It's been called the "love hormone" because studies have shown that it is released during labor and breastfeeding. Children soothed by their mothers produce it, and, apparently, it has a role in easing social interactions. Oxytocin is a hormone secreted by the pituitary gland. It is a neurotransmitter, which basically means that it helps send signals from the brain to the receiving cells.

OXTR is the oxytocin gene receptor, in other words, this gene codes the protein that sits on the surface of the cell waiting to "grab" the oxytocin. So, if oxytocin has such beneficial effects on our behavior, it seems natural to look into this gene and see how it affects us, right?

That's exactly what a study published in this week's issue of PNAS [1] did. The researchers (from UCLA, UCSB, and Ohio State University) found one particular SNP in OXTR to be associated with three psychological traits: optimism, self-esteem, and mastery (the ability of making decisions, of being determined to achieve certain outcomes in life). This is an important finding, since the traits they found to be linked with OXTR are known to be correlated with positive health outcomes and good stress management.

Okay, let's back up a little. What's a SNP?

You and I share most of our DNA. We all do. There are very few loci where DNA differs across people, and SNPs are some of those loci. SNP (pronounced "snip") stands for Single Nucleotide Polymorphism, and it represents one particular base in the DNA that's found to be changing across the population (hence the "polyphormism"). It's a single base, but because we have two copies, it is represented by two nucleotides. The SNP found in the PNAS paper, for example, is represented by the following alleles in the population: AA, AG, and GG. In other words, when you look at people's DNA at that particular position, you'll find that some carry a GG, some an AG, and some others an AA. So how was the association found? The researchers recruited a number of subjects and found out which alleles they carried. Then they measured their psychological traits, and they saw that individuals that carried the "A" allele had a tendency to have lower levels of optimism, self-esteem, and mastery, and higher levels of depression.

Now to the caveats.

In general, looking at one SNP only gives a somehow limited picture. Genetics is not just DNA, rather a very complicated hierarchy of interactions, mechanisms, and cascade effects. Genes often interact and "combine" forces. For example, groups of multiple SNPs tend to be inherited together, and "piggy-back" mutations appear as an effect of chromosomal recombination. In this case in particular, this hypothesis seems plausible given the fact that the SNP under investigation is silent, hence does not affect the structure of the protein OXTR encodes. Furthermore, one must keep in mind that certain traits can be altered by epigenetic changes. Caveats aside, it is certainly fascinating to see how genes can affect our behavior and state of mind, and I look forward to the next papers from this group.

[1] Saphire-Bernstein, S., Way, B., Kim, H., Sherman, D., & Taylor, S. (2011). Oxytocin receptor gene (OXTR) is related to psychological resources Proceedings of the National Academy of Sciences, 108 (37), 15118-15122 DOI: 10.1073/pnas.1113137108

Photo: aspens at sunset. Canon 40D, focal length 81mm, F-stop 5.6, shutter speed 1/100. On a side note, those three aspens came down this summer. Too much wind, sadly.

Superpowers, ice ships, and spies: the alternate worlds of Ian Tregillis

"My parents, a bearded mountebank and a discredited tarot-card reader, settled in the Minnesota Territory after fleeing the wrath of a Flemish prince. There they conspired to mark me with a Cornish surname and Macedonian blood."

Thus begins the life of Ian Tregillis, scientist, novelist, Clarion graduate, and, may I add, wonderful friend of mine. Ian's short fiction has appeared in the DAW anthology, Tor.com, and Apex magazine, and his alternate history novels, the Milkweed Trilogy, are published by Tor. Bitter Seeds, the first in the trilogy, came out last April, and the paperback edition, as well as The Coldest War (book II in the trilogy), will be released next summer with brand new cover art. (Check it out -- it's awesome!)
 
Between chats over writing, Raymond Chandler, gamma rays and Klein bottles, I asked Ian a few questions on how science and literature mingle in his life.

EEG: One of the best kept secrets of being a scientist is how much creativity and imagination goes into research. Do you think that being a writer makes you a better scientist and, vice versa, that being a scientist makes you a better writer?

IT: I am utterly convinced that the writing and science parts of my life have had a very positive influence on one another.
 
When I began to write fiction, I quickly learned that I lacked the skill to say things as clearly and succinctly as possible.  In fact, I think the first "breakthrough" I had as a beginning writer was when I learned to recognize excess verbiage and how to eliminate it.  (A skill I'm still trying to master, as you might infer from my answers to your questions...)  Along with that came the ability to see better ways to rephrase things.  After a while, it became second-nature. I'll bet most writers do it without even thinking about it-- I know I'm constantly looking at fragments of writing (blog posts, cereal boxes, billboards, mattress labels, you name it) and automatically try to improve them.

And that tendency has been a huge boon to my scientific work.  Writing is a crucial part of the life of a professional scientist (as you know, Bob...)  First and foremost, of course, we write to publish our research results in journals and conference proceedings. But we also write grant proposals, and work packages, and milestone documentation... the list goes on and on.  Not to mention simply writing messages to our colleagues and collaborators about the day-to-day details of our work.  The bottom line is that communication is absolutely essential to good science.  Knowing how to write clearly means knowing how to communicate clearly!

Which means my efforts at writing fiction have vastly improved my scientific efforts, by making me a better communicator.  So much so that I sort of wish I'd started writing earlier; my thesis isn't terrible, but it does have the occasional passage that makes me cringe.

And the feedback goes the other way, too.  My science background (particularly at the hands of my thesis advisor) taught me how to ask questions... and to not stop asking them.  And that's a very valuable skill when you're building a world, or developing a magic system, or reverse-engineering a murder mystery!  It seems like a strange thing to say (because it is!) but sometimes it's really helpful to apply a certain rigor to the creative process.

When I was writing Bitter Seeds, I wanted to play with certain ideas about superpowers.  My original concept was that each superpower would manifest as a specific violation of one (and only one) law of physics.  Well, I tossed that conceit out the window pretty quickly!  (Too constraining.  Also, given the choice between writing a "rigorous" fantasy, and having fun, I'd rather just have fun.)  But I'm glad I started there, because it led me to start asking difficult questions.

For instance, there is a character who can walk through walls. And I thought it would be fun (and halfway logical) if he couldn't breathe while he was insubstantial-- after all, if his body didn't interact with normal matter, his lungs couldn't interact with oxygen.  So that's a part of the story.  But the same logic also dictates that he should sink straight through the floor if he doesn't become immune to gravity when he becomes insubstantial!  So I had to think about that. (And in that case the explanation turned into an entire short story, which was published separately.)  But once you start peeking behind the curtain, there's no end to the questions.  Because, gosh, if his lungs can't interact with oxygen molecules, then his eardrums can't interact with sound waves, so he would also be deaf while insubstantial...

There comes a point where, as the author, you just have to skate fast...

But it's important to know where the thin ice is. Asking the right questions (once I figure out what they are) helps me to delineate those boundaries.  And science is all about asking questions.

EEG: Sure is! Can you think of any particular instance when you were sitting at your desk doing science and you came across a concept that (bang!) spurred a great idea for a story?

IT: For some reason, my day job doesn't often inspire writing ideas for me.  Part of that might be because I'm not particularly drawn to writing hard SF, which demands a fair bit of rigor.  By the time I arrive at home after work, I'm often more interested in exercising the other brain hemisphere without so much constraint!  Also, I think that if I were to start writing hard SF, it would feel like taking work home with me.  Or that my day job was insinuating itself into the personal, joyful side of my life.  I strive to keep my work and writing lives separate.

I don't have anything against reading hard SF.  I just don't feel interested in writing it.  That might make me unusual-- there are certainly plenty of hard-SF writers who come from science backgrounds, either as moonlighting scientists or "reformed" researchers...

Having said all that, though, the occasional story fragment will flutter through my head when I'm reading up on something.  It's more common when I'm revisiting work I did in graduate school, where my research was in astrophysics.  My current research hasn't (yet) been a good spark for the creative instinct.

EEG: Tell us about your books: your prose is poetic and evocative, your characters memorable. I'm always fascinated to hear the "one idea" (or image) that spurred the book/series...

IT: The Milkweed trilogy had quite a few influences.   I'm like many writers in that I tend to take in lots of little bits and pieces of ideas -- words, concepts, trivia, minutia, news articles, random snippets of conversation, dreams, anything.  I imagine that they all go into something akin to a cement mixer in the back of my mind.  They tumble around and around, and every so often through random collisions a pair of unrelated ideas will get juxtaposed.  If that happens long enough, the slow accretion process will eventually give rise to a full-fledged story idea. That's the point where I have a concept weird enough to hold my interest, but with enough nooks and crannies that I can get a solid grip on it.  (I'm sure that analogy won't make sense to anybody but me.)

But anyway... the original seed idea that kicked off the cement mixer for Milkweed was an article about an obscure piece of World War II history called Operation Habakkuk.  It's a strange and marvelous story: during the Battle of the Atlantic, when German wolfpacks were inflicting heavy losses on Allied shipping convoys, the Allies seriously considered building aircraft carriers out of ice.  (A special form of ice, but still.)  The project never made it past the small-prototype stage, but I just couldn't shake the image of vast bergships plying the ocean.  And then I got to wondering what might have happened if the project *had* succeeded.

Well, I figured, Germany would send a spy to North America, to sabotage the frozen shipyards.  Who better for the job than a pyrokinetic?  And the story grew from there.  It grew from what I thought was a single short story, to what I thought was just a single book, to a trilogy with multiple short stories dangling off the sides.

And yet the ice ship never made it into the trilogy...

EEG: Really? Not even in the next books? What about in future stories?

IT: It's funny, in a way, because that ship was the impetus that pushed me to chart out this complicated story.  But the more I figured out the world, and got a handle on the characters and their struggles, the less room there was for a plotline involving icy Canadian shipyards.  By the time I knew what the general plot of the trilogy would be, it was clear there just wasn't going to be room for the ice ship without making it a major digression.  "Murder your darlings," as we writers reluctantly tell ourselves...
 
Bitter Seeds is an alternate history.  But in my head, there's an alternate history of that alternate history, one where the ice ship does play a role.

EEG: Okay. I still think you should write a story with the ice ship, though. You know I'm not a particular fan of that murdering darlings thing!

Thanks so much, Ian, for taking the time to answer my questions. I can't wait to read the next installment in the Milkweed trilogy! To find out more about Ian's books, visit him at www.iantregillis.com.

Photo: Abstractions. Canon 40D, focal length 85mm, F-stop 5.6, shutter speed 1/8, ISO 100. 

How did that pesky virus end up in our DNA?

Last time we talked about the different types of genetic and epigenetic chimeras. We learned what a chimeric virus is, and that retroviruses need to get integrated into the host's DNA in order to replicate. They basically inject their RNA into the cell, the RNA gets transformed into DNA, the viral DNA enters the cell's nucleus and once in the the nucleus it's integrated into the cell's DNA.

This process has been going on for as long as viruses have existed. And viruses have existed for a long time.

Normally we think of viruses as pesky little things. Flu viruses are annoying, more serious viruses like HIV or HCV are deadly. Well, you'll be surprised to know that over the course of evolution, viruses have driven genetic diversity by transferring genes across species. How do we know that? We know because we all carry ancestral DNA derived from viruses in our genome. There are roughly 100,000 copies of endogenous retroviral DNA in our genome [1]. In other words, we're all chimeras!

But... how did the retroviral DNA get there?

The mechanism is fascinating. You see, when a virus enters the body, it has one purpose: replicate, and to do so it needs to infect cells. Every virus has its own preferential cells. HIV, for example, infects mostly T-lymphocytes, but it also creates huge reservoirs in the guts. So imagine a platoon of viral particles trying to eat up whatever they can as they migrate around the body. Well, sooner or later, some virus will find a very special set of cells: the gametocytes, a.k.a. oocytes in women, and spermatocytes in men. And once in there the virus is stuck. Because you see, gametocytes will not duplicate unless they get fertilized. But by then the virus is no longer active. It's literally stuck, in the sense that the integrated viral DNA now cannot replicate and cannot escape the host's DNA.

What happens if the infected gametocyte gets fertilized?

Once fertilized, the cells start reproducing very fast. Every cell in the newly created embryo will carry the bit of viral DNA, which has now become non-coding. The new individual will carry the viral proteins everywhere, even in his/her own gametocytes, and hence the viral proteins will be inherited by his/her offsprings as well.

And that's how viruses ended up in our genome a long, long time ago.

Wait, my story isn't over yet. Now I'd like to convince you that this hasn't been some futile genetic exercise. Remember, I'm a fan of non-coding DNA. It holds the key to evolution. And as species continued to evolve, sure enough, Mother Nature found a way to use those non-coding viral proteins. The viral genes became beneficial to the host. 

Here's the scoop: viral genes are expressed in the placenta [2]. Why? Well, we don't know for sure, but the hypothesis are intriguing [3].

Retroviruses debilitate the immune system. In general, this is not a good thing for the body, except in one very special instance: an embryo is literally a parasite growing inside the mother's body. It carries extraneous DNA and, under normal circumstances, something carrying extraneous DNA would be considered by the immune system an antigen. But a fetus is not to be considered an antigen. Therefore, the expressed viral proteins found in the trophoblasts, the outer layer of the placenta, would have the role of suppressing a possible immune reaction against fetal blood.

Another property viruses have is that of cell fusion: they literally "merge" cells together into one membrane. A second hypothesis is that this property is used during the development of the placenta to build a barrier between the maternal circulation and the fetal circulation.

Let me conclude with a caveat: as always, when talking about evolution, it's easy to slip into thinking that certain genes evolved to fulfill a specific function. In reality, we know the placenta evolved because it presented an advantage compared to laying eggs. The beauty of DNA is that it holds not just the present information, but the memory of the information needed to get there. It's this redundancy that allows it to explore new solutions, but it's only a posteriori that we can retrace this path and give it a meaning.

REFERENCES:
[1] Emerman M, & Malik HS (2010). Paleovirology--modern consequences of ancient viruses. PLoS biology, 8 (2) PMID: 20161719
[2] Dunlap KA, Palmarini M, Varela M, Burghardt RC, Hayashi K, Farmer JL, & Spencer TE (2006). Endogenous retroviruses regulate periimplantation placental growth and differentiation. Proceedings of the National Academy of Sciences of the United States of America, 103 (39), 14390-5 PMID: 16980413
[3] Dupressoir A, & Heidmann T (2011). [Syncytins - retroviral envelope genes captured for the benefit of placental development]. Medecine sciences : M/S, 27 (2), 163-9 PMID: 21382324

Picture: Onion blossom. Canon 40D, shutter speed 1/500, focal length 85mm. The deer repellent spray may have something to do with the weird horn-like growth. It's been three months and the thing hasn't blossomed yet. I think next time I'll let nature take its course.

Reflections

We've been having New England weather here in the Southwest, and the fun part about shooting pictures after the rain is playing with light and water drops.

Photo: sunflower and sunflower reflections. Canon 40D, focal length 85mm, shutter speed 1/40, f-stop 7.1, ISO 100.

Ghost Town

I live in a town of geeks. Whenever people ask where I'm from, the next comment upon hearing the answer is, "Oh, you must be a scientist, then."

I must be, of course. Some weird fate bestowed upon me.

It's contagious, too. We had guests over last week, and as they strolled in downtown, a lady asked them what they were doing here. They replied they were visiting friends, and the lady shook her head and said,  "Oh, you must be scientists, then."

Apparently, being a scientist is the only reason to either visit or live here.

As if the place wasn't weird enough on its own, I heard this news this morning on NPR: Tech Company Builds a Ghost Town in New Mexico.

And then I saw it again on DISCOVER: If You Build a Ghost Town in the Desert, the Geeks Will Come.

Now, now. Gotta shake my head.

First of all, it's a big state, and it's not all desert. The fires should attest to that. Maybe after the fires have burnt the whole thing down, but so far there's still trees. Second, the geeks are already here. That's what makes the place so darn interesting. Besides the fires. And the bears. And mountain lions perched on people's roofs. And the radiation, how could I possibly forget the radiation?

So, what's new? New Mexico has a lot of land and wants to use it. It's good for the economy. For the past few years, the state has been luring the movie business for the same reason. We all crane our heads and rubberneck during our 5-minute commute to work when the trailers from Hollywood spread out in the high school parking lot. I watched Brothers just to see why I had to drive two extra miles for a week when they blocked the street to my son's school. (It was a two minute scene in the movie.) I can name all the places in the Let Me In trailer. (That's all I watched of that one; not very fond of vampires, sorry.)

You wait and see. I'm sure Hollywood is already lined up to use Ghost Town once the techies are done with it. Like I said, it's good for the economy.

Photo: Ghost Sky. Canon 40D, focal length 41mm, f-stop 7.1, shutter speed 1/60.

The neuroscience of politics

Fascinating article over at DISCOVER Magazine: Your Brain on Politics: The Cognitive Neuroscience of Liberals and Conservatives, by Andrea Kuszewski. Very well written and mindful of all the caveats.

Photo: dawn. Shutter speed 1/160, focal length 70mm, ISO 100, F-stop 5.6. I know, I keep photographing the same trees. It's because if I photograph them often enough, God will give them to me. Just kidding. Click on the link to see whom I'm paraphrasing.

Chimeras unveiled: genetics versus epigenetics

You think you know everything about chimeras? Well, think again: today I'm about to surprise you.

Let's start from the very beginning: in Greek mythology the Chimera was a monster, part goat, part snake and part lion.

Like with many other things, genetics borrowed the term to define organisms that are the result of genetically different tissues fused together. This happens at conception, when two fertilized eggs fuse together to form a single individual. Conceptually, it's the exact opposite of identical twins, where one fertilized egg splits into two identical individuals. Chimeric animals, for example, will present bits of fur of different colors. A chimeric person may show different pigmentation across his or her body. The individual will have two distinct DNAs in different tissues.

I'm sure so far I haven't told you anything new.

One day one of our experimentalist collaborators called to tell us they'd found a chimera. He was quite excited about the discovery. I scratched my head. Because you see, he was talking about HIV. And the thing with HIV is that it has one molecule of RNA. Just one, that's all there is. And so, how can a virus be the result of "tissues" coming from different genomes?

It turns out the definition is slightly different for viruses. A chimeric virus is a virus that has bits of extraneous DNA in its genome. Here I should be careful: HIV is a retrovirus, which means a free viral particle carries RNA, not DNA; however, once it enters the cell, an enzyme called reverse transcriptase turns it into DNA and, as DNA, it enters the host cell's nucleus and gets integrated into the host's DNA. This integration is what allows the virus to replicate. It's also what caused our chimeric virus to integrate in its own genome part of the host's genome.

The concept is used in gene therapy: a retrovirus is basically a shell (called envelope) with genetic material inside, and it's designed to inject the genetic material into the cell's nucleus. This is a fundamental step in the retrovirus's life because without it, it can't replicate. Many gene therapy clinical trials have exploited this mechanism by genetically engineering a chimeric retrovirus that carries human genes. Once the virus enters the nucleus, it delivers the new genes, thus "fixing" the problematic ones. I will talk more about gene therapy in a future post.

So now you've met a new type of chimera. Wait, it's not over yet.

Remember when I introduced the concept of epigenetics? Remember what pseudogenes are? They are ancestral or redundant parts of our DNA that are usually non-coding. We learned in those earlier posts that epigenetic processes do change during one's lifetime, and, as a result, pseudogenes can be activated and become coding genes. They are called chimeric genes.

An individual with chimeric genes is what I call an epigenetic chimera. The individual has the same DNA across all of his or her tissues, but some cells express genes that are otherwise non-expressed in the species.

In summary, we have three types of genetic chimeras: individuals with different DNAs; viral particles integrating different bits of extraneous DNA; and individuals expressing different chimeric genes.

Now that you know the different types of genetic chimeras, you are ready to learn why you and I are chimeras, too. 

Picture: Statue of Hutshepsut, Metropolitan Museum of Art, New York City. Canon 40D, focal length 85mm, shutter speed 1/10. Hutshepsut was a female pharaoh, often depicted in a masculine attire and with the typical pharaoh beard, symbol of pharaonic power.