The fossils hidden in our genome: geneticists turn into archeologists ... sort of.

I often blog about viruses because, well, I work on viruses. Here's a quick summary of things I've blogged about that I find absolutely mind-blowing:

1. About 10% of the human genome is made of genes we inherited from viruses that had replicated in our ancestors millions of years ago.

2. Viruses evolve as their hosts evolve (The Red Queen Effect), and in fact we can retrace their evolution in parallel with that of their hosts. The same is true within a single host, enabling us to retrace the evolution of a single virus in parallel with that of the host's antibodies.

3. Genes expressed by viruses and bacteria in our body can affect our phenotype.

4. We can use the ability of viruses to target certain cells to devise new cancer therapies.

5. We can use viruses to edit the genome of certain cells and cure genetic defects through gene therapy.

So yes, viruses are cool and they play a huge role in evolution. The fact that roughly 10% of our genome is made of viral elements (called human endogenous retroviruses, or HERVs) makes our DNA a "living fossil": these are viruses that infected our ancestors millions of years ago. Retroviruses in particular insert their genome inside the cell's DNA in order to replicate. In some instances, these viral genomes got stuck inside germ line cells and that's how they got passed on to the host's offspring and became part of our DNA.

Today these viruses are extinct, as they evolved into new forms, but by investigating the inactivated genes they left in our genome, researchers can find out what they looked like millions of years ago. It's like digging out fossils in our own cells.

It's exactly what two scientists from The Rockefeller University did with one family of HERVs in particular, HERV-K(HML-2) believed to have replicated in human ancestors less than one million years ago (making it one of the most recent forms found in the human genome). They looked at several of these genes across different subjects and reconstructed a "consensus genome", in other words, a genetic sequence that at each DNA position had the nucleotide most frequently found across all study subjects.

For example, if the samples across all subjects looked something like this, with the differences, highlighted in red (made up sequences!!):

then the consensus sequence would be one of the sequences without red mutations because they represent the majority, in other words:

GATACTTGGACAGGAGTTGAAGCTATAATAAGAATTCTACAACAACTGCT

Back to the HERV study, which was published in PLoS Pathogens in 2007, Lee and Bieniasz recreated the HERV-K consensus from ten full-length HERV-K(HML-2) sequences and then reconstituted the virus in the laboratory. The ten sequences were selected based on their similarity to HERV-K113, a relatively young and intact HERV-K provirus. While all ten sequences had defects that made viral genes inactivated, selecting the most frequent base at each position, eliminated these defects and yielded a full genome sequence (the consensus) with intact proteins. This derived consensus sequence may not be 100% identical to the actual virus that was integrated into the human genome close to a million of years ago, but it's pretty close. This "closeness" was confirmed in the lab when the scientists saw that the virus they reconstructed based on the consensus genome was indeed able to infect T cells in vitro. All proteins of the reconstructed virus were functional and able to carry one the virus's replication cycle.

It's like Jurassic Park... for viruses. :-)

Lee, Y., & Bieniasz, P. (2007). Reconstitution of an Infectious Human Endogenous Retrovirus PLoS Pathogens, 3 (1) DOI: 10.1371/journal.ppat.0030010

Starting the year with some new composites

Last year I only made one composite. That doesn't mean that I wasn't busy doing other stuff, but somehow the thought nagged me. Then last September I had a show at our local gallery with my old composites and the outpour of love and appreciation got me going again. So my new year's resolution is to make more composites.

Here's my first 2016 series, titled The Lady and the Lamp. Enjoy!

As always, prints can be purchased here or here.

The Land of Enchantment

Some of my latest shots, all taken within a few miles from where I live. yes, I'm a lucky gal. Can you guess which ones are sunsets and which sunrises?

As always, prints can be purchased here or here.

The 2015 Dietary Guidelines for Americans are here. And Americans should read them.

Rigatoni pomodorini e tonno. 

Today the FDA released the updated Dietary Recommendations for the USA. The whole document is available on the Internet for free, and you should read it:
http://health.gov/dietaryguidelines/2015/guidelines/

People are going to hate me for this post, but I'm going to post it anyway because somebody needs to say it. When I open Facebook, half of the posts are about how women should love their bodies. What gets me is that nobody says that loving your body is not only about accepting the way you look. Overweight is not healthy. You are not loving your body unless you adopt a healthy lifestyle.

From the guidelines released today:

"In addition, the eating patterns of many are too high in calories. Calorie intake over time, in comparison to calorie needs, is best evaluated by measuring body weight status. The high percentage of the population that is overweight or obese suggests that many in the United States overconsume calories. As documented in the Introduction, Table I-1, more than two-thirds of all adults and nearly one-third of all children and youth in the United States are either overweight or obese."

I look around and I don't see a healthy society. What's even more saddening is that I see young people getting more and more overweight. This is particularly bad because the way the body stores fat is something that is shaped during childhood. Epigenetic marks that regulate the usage and storage of nutrients are set during childhood and are highly affected by the diet. So, a diet high in fats will make a person prone to diabetes and all sorts of health problems.

But this is epigenetics, not genetics. This means that these marks are reversible if you catch them in time. On the other hand, if you don't do anything about it, these epigenetic marks will be passed on to your children and, chances are, to your children's children. In fact, I believe that many of the overweight kids we see today have inherited the marks from their parents. Coupled with an unhealthy lifestyle acquired from home, you have a recipe for disaster: more health bills and a lifetime dependency on medications and their side effects.

America, is this where you want to go?

I grew up on a Mediterranean diet and I never had to go on a weight loss diet in my life. Contrary to what you've been told, carbs are not bad for your health unless you have diabetes or an allergy to gluten. And on a side note, the growing rate of allergies is again the biproduct of unhealthy life styles. And let's face it: anything will make you fat when overconsumed. The key to health is balance. 

The Mediterranean diet is one of the easiest to adopt and it's scientifically proven to provide long-term health benefits [2,3]. Below you can find two of the many papers on how adherence to the Mediterranean diet was found to lower the risk for certain cancers and circulatory diseases. You can find many more on Pubmed. 

Pasta makes for fast and easy recipes, and you can add proteins and vegetables for a complete meal. I shared some recipes here. The image above is another super easy one: Rigatoni Pomodorini e Tonno. All you need is a box of pasta, a can of tuna fillets (I prefer the ones that come in a glass jar, they are a bit more expensive, but the taste and quality are way better), a small container of fresh cherry tomatoes, olive oil, and oregano. 

Half the cherry tomatoes and sauteed them in two tablespoons of olive oil for a few minutes. Add the tune fillets, salt, pepper and oregano, and let simmer for a few minutes. Cook the pasta al dente, drain it and toss it in the pan. Mix well and serve. Voila', a healthy meal is served. :-)

[1] U.S. Department of Health and Human Services and the U.S. Department of Agriculture (2015). Dietary Guidelines for Americans 2015-2020, Eigth Edition health.org DOI: 10.1037/e516742014-001

[2] Mancini, J., Filion, K., Atallah, R., & Eisenberg, M. (2015). Systematic Review of the Mediterranean Diet for Long-Term Weight Loss The American Journal of Medicine DOI: 10.1016/j.amjmed.2015.11.028

[3] Schwingshackl L, & Hoffmann G (2015). Adherence to Mediterranean diet and risk of cancer: an updated systematic review and meta-analysis of observational studies. Cancer medicine PMID: 26471010

Happy New Year and happy first USWG post of the year

This is a monthly event started by the awesome Alex J. Cavanaugh and organized by the Insecure Writer's Support Group. Click here to find out more about the group and sign up for the next event.

Happy New Year everyone! This first ISWG post celebrates the winners of the IWSG Anthology Contest. If you haven't done so, visit Alex J. Cavanaugh's blog to find out who the winners are. Many thanks to this month's co-hosts: L.G. Keltner, Denise Covey, Sheri Larsen, J.Q. Rose, Chemist Ken, Michelle Wallace.

I hope everyone had a wonderful holiday break. Did you take the time to make an assessment of the past year and new writing resolutions for the new year? My 2015 wasn't too bad -- I did publish 3 books after all -- but I confess that I'm much happier with my photographic accomplishments of the past 12 months than the writing ones. Which is sort of ironic, because I expected the year to go in the opposite direction. Oh well, so long as there is some progress I shouldn't be complaining, right? :-)

My new year resolution is to not to be afraid to take my time. If a story needs more time, then be it. Sometimes characters need to simmer for a little a while before their true personality can come out, right?

What about you, what are your new year resolutions in terms of writing and publishing?

Riso, Patate e Cozze

Happy New Year. On new year's eve we usually make a typical dish from Puglia, a region in Southern Italy, and since the recipe involves several steps, this year I decided to document every step with my camera. The result? A photorecipe that I'm sharing here in case you want to try it too. So here it goes: Riso, Patate e Cozze (Rice, Potatoes and Mussels).

Ingredients: potatoes (peeled and sliced), 1 yellow onion, basil, parsley, parmesan, garlic (chopped), grated parmesan, bread crumbs, 1 can of crushed peeled tomatoes, parboiled rice, salt, pepper, extra virgin olive oil.

And mussels, of course, boiled, opened, and halved. If fresh aren't available, you can use the precooked ones you find in the frozen seafood aisle.

Layer mussels at the bottom of a pan, add chopped onion and garlic, parsley, basil, salt and pepper.

Generously sprinkle with parmesan.

Layer potatoes slices.

Add pepper, salt, onion, garlic, parsley, and basil.

Sprinkle with parmesan again.

Add parboiled rice (the kind of rice is very important, has to be parboiled).

Spread the rice evenly on top of the potatoes.

Sprinkle with parmesan and add, once again, salt, pepper, parsley, onion, garlic, and basil.

Spoon the crushed peeled tomatoes and spread over the layer of rice.

Spoon the crushed peeled tomatoes and spread over the layer of rice.

Sprinkle with parmesan.

Add another layer of potato slices.

Sprinkle with salt, pepper, onions, garlic, parsley, and basil.

More parmesan.

Lots of extra virgin olive oil.

Last layer: bread crumbs, evenly distributed on top.

Now add water: we used the tomato can, just fill it with water and then pour it into the pan from one corner so not to disassemble the layers. Pour until the rice is completely covered.

Bake for 1 hour at 350.

Enjoy!

Holiday Recipes

Happy New Year! I hope you had a wonderful holiday break. Mine was very relaxing.

One of my favorite activities was cooking, paired with food photography -- which, you may think is obvious and easy but it's not! Something that looks inviting may turn out to be totally meh in a picture. Here are some of my best shots (with recipes), but I also threw away many shots that turned out very bad. I think the best for food photography is a good macro lens that enhances textures and good eyes for surroundings, like a nice table cloth and simple china/silverware, for example. The highlight needs to be the food itself, so avoid too much clutter in the picture. Enjoy!

Farfalle al Salmone

This is one of our favorite dishes for the holidays: Farfalle al Salmone. For this one, you'll need a package of smoked salmon, fresh chives, a box of bowtie pasta, creme freche or half and half, butter and 1 lemon.

Cut the smoked salmon in small pieces, sautee' it for a few minutes in a pan with melted butter, then add about half a cup of creme fraiche or 1/2 and 1/2. Simmer a few minutes until the cream is thick. For an even creamier texture, add two tablespoons of mascarpone. In the meantime, cook the farfalle al dente, drain them, then toss them in the pan with the salmon. Season to taste with pepper and salt (though usually the smoked salmon is already salty). Mix well, then serve with chopped chives and lemon zest on top.

Spinach-filled Baguette

I got the above recipe from a friend and modified it slightly: spinach-filled baguette. Makes a fantastic appetizer. You'll need one baguette, green onions, one bag of pre-washed spinach, cream cheese, shredded mozzarella, butter, parmesan cheese, olive oil, paprika flakes, nutmeg, salt and pepper.

Melt some butter in a pan, sautee' two chopped green onions, then add the spinach and season with salt, pepper, paprika, and nutmeg. stir until the spinach are wilted, then reduce the heat to low. Add about 1/3 of a cream cheese tablet, cubed, and stir until melted. Remove the pan from the stove and add about 1/2 cup of shredded mozzarella and 4 tablespoons of parmesan cheese. 

Prepare the baguette: cut it in fourths, hollow them, then slice them without separating the slices. This will make it easier to separate the slices when serving without squeezing out the filling. Spoon the filling inside, then sprinkle the top with olive oil and parmesan cheese. Wrap the baguette fourths in aluminum foil and bake at 350 for 20 minutes.  

Penne alla Crema di Spinaci

Finally, I had some leftover of the spinach filling from the recipe above. It was a bit too thick, so I added some 1/2 and 1/2 and then tossed over some penne pasta. It was delicious !!!!

Hope you enjoy these recipes, if you end up making them let me know and send me some pictures too. :-) Happy New Year!

Happy Holidays from Chimeras

Happy Holidays and Best Wishes for a 

peaceful, joyous, and healthy New Year.

Scientists reproduce a stress-induced phenotype in mouse pups thanks to epigenetic reprogramming

© Elena E. Giorgi

I'm excited to be blogging about science again, albeit only occasionally. Those of you who have been following the blog from its very beginnings, back in 2011, know that I've always been fascinated with epigenetics, one of my favorite topics to discuss. So much so that I've managed to include it into the plot of my detective thriller Chimeras. The thrills in the book are fictional, but the science is all real.

I was talking with my colleague Karissa Sanbonmatsu last week, who's been working on RNA and epigenetics since the early 2000s, and she was telling me how the field is still riddled with controversy. There's more and more evidence that environmentally triggered traits like stress, fat storage, and the propensity to acquire certain diseases can be passed on from one generation to the next via activated epigenetic marks, yet many scientists still refuse to believe it. How can things that are not encoded in the DNA be transmitted to the new generation? Germ cells carry epigenetic signatures that have been shaped by the environmental exposures from the parents, but how are these signatures communicated across generations?

A little background.
Our cells carry long bits of RNA that sense molecules and their changes in concentrations. Depending on the environmental exposures they find, they recruit epigenetic factors that then activate certain genes and/or deactivate others. This happens by inducing changes in the chromatin, the big yarn of DNA that sits inside the nucleus. When a gene needs to be activated, the big yarn moves until that particular gene is exposed on the surface and then translated into proteins. On the other hand, to silence the gene, the chromosome move around again and "hide" the gene deep inside the chromatin. RNA molecule act as regulators of these mechanisms, "deciding" which genes to activate and which ones to silence.

A recent study published on PNAS sheds new light on the mechanisms that communicate epigenetic marks from the germ line to the offspring, proving that epigenetic signatures acquired by the parents can be passed onto the offspring. Rodgers et al., from the University of Pennsylvania, used a mouse model to establish the following points:

• First, they exposed male mice to chronic stress prior to breeding, and then observed reprogramming of certain genes in the hypothalamus of the offspring;
• Second, they looked at the sperm of the stressed mice and compared it to the sperm of non-stressed mice; they found a change in content of micro RNAs (miRNAs), and 9 miRNA molecules in particular were found in much higher concentrations in the stressed mice's sperm [1]. Rodger et al. hypothesized that the 9 miRNAs were responsible for the genetic reprogramming induced by the chronic stress exposure and passed on through the paternal line.

To prove it, they injected the 9 miRNAs into single-cell zygotes that were then implanted into normal female mice, raised with no stress exposure, and then examined to see if they presented the same stress phenotype observed in the stressed male's offspring. Indeed, expression of the target genes in the hypothalamus was reduced in the mice that originated from these zygotes, and the expression patterns observed in these mice recapitulated what they had observed in the offspring of the stressed mice.

This study, published in PNAS last october [2], is a milestone in epigenetics, as it finally shows a molecular mechanism that allows genetic reprogramming in the parent to be transmitted to the offspring.

As a final thought, I want to toss in my two cents on the debated rise of autism spectrum and ADHD disorders currently observed in the Western world. Of course, there's the caveat that the diagnostic methods have changed drastically in the past few decades. Still, the increase seems real and the sad truth is that there's probably more than one cause, and the causes lie not just in what the child has been exposed to, but, once you throw in epigenetics into the pictures, his/her parents and grandparents as well. My parents for example grew up at the peak use of asbestos, DDT, and lead in paint. Yes, they survived and, knock on wood, they are quite healthy in fact. But I do fear that we will carry the consequences of those exposures for a few more generations. And who knows what the current exposure to the massive use of corn syrup and antibiotics will do to future generations. Food for thought.

[1] Rodgers AB, Morgan CP, Bronson SL, Revello S, & Bale TL (2013). Paternal stress exposure alters sperm microRNA content and reprograms offspring HPA stress axis regulation. The Journal of neuroscience : the official journal of the Society for Neuroscience, 33 (21), 9003-12 PMID: 23699511

[2] Rodgers, A., Morgan, C., Leu, N., & Bale, T. (2015). Transgenerational epigenetic programming via sperm microRNA recapitulates effects of paternal stress Proceedings of the National Academy of Sciences DOI: 10.1073/pnas.1508347112

Fog !!!!

Fog doesn't happen very often here in the Southwest, so when it does descend upon us, I feel like I just hit the jackpot. We had a nice snowstorm over the week-end and as soon as the fog rolled in, I grabbed the camera and ran out. I even chanced on a nice, friendly crow. :-)

A few hours and layers of textures later, this is what I have to share. Prints available here.
Enjoy!