The viruses inside us

Dendogram of endogenous retroviruses. Source: Wikipedia.

Last month I posted a discussion on a PNAS paper that reported the discovery of a new class of viruses, called pithoviruses, found in a layer of Siberian permafrost. In their paper [1], the researchers conclude:

"Our results further substantiate the possibility that infectious viral pathogens might be released from ancient permafrost layers exposed by thawing, mining, or drilling."

I found this possibility intriguing both from a scientific point of view as well as a sci-fi point of view: there are plenty of books out there on zombies and aliens, but what about ancient viruses that thawed from the ice thanks to global warming?

An attentive reader, though, didn't buy the sci-fi "threat" and asked in the comments whether viruses are necessarily bad. Normally we think of viruses as pesky little things. And while most will make us sick for a short time only, some can indeed be deadly, and others can inflict long-term complications.

The reader who asked that question, however, is absolutely right: over the course of evolution, viruses have been beneficial to us. Viruses have driven genetic diversity by transferring genes across species, and in fact, we still carry remnants of viral genes in our DNA, comprising roughly 8-10% of our genome. They are called "endogenous retroviruses", or ERV.

In the rest of this post I will address two questions:

• What are those viral genes doing in our genome?
• How did they get there?

What are viral genes doing in our genome?

Most of them are doing nothing. They are "deactivated", meaning they do not code for proteins. Our genome is made of many redundant elements that over the course of evolution were silenced because no longer useful, only to be turned on again later on when a new adaptation happened.

One such example is the placenta, where endogenous retroviruses have been found to be expressed [2-4] and play a role in the growth and implantation of the tissue. We can only speculate on why retroviral genes are expressed in the placenta, but the hypothesis is indeed quite interesting: in order to survive, retroviruses debilitate the immune system. In general, this is not a good thing for the body, except in one very special instance: an embryo is literally a parasite growing inside the mother's body. It carries extraneous DNA and, under normal circumstances, something carrying extraneous DNA would be considered an antigen and attacked by the immune system. Therefore, the expressed viral proteins found in the trophoblasts, the outer layer of the placenta, would have the role of suppressing a possible immune reaction against fetal blood.

Another property viruses have is that of cell fusion: they literally "merge" cells together into one membrane. A second hypothesis is that this property is used during the development of the placenta to build a barrier between the maternal circulation and the fetal circulation.

How did viral genes end up in our genome?

A virus enters the body of a host with the sole purpose of replicating. In order to do so, viruses hijack the cell's own replicating machinery. Retroviruses in particular carry strands of RNA which, once injected inside the cell, are turned into DNA that is then carried inside the cell nucleus and integrated into the cell's genome. This ensures that once the cell replicates, the bit of viral DNA is replicated too.

There is a special set of cells, however, such that when the virus infects them it literally gets stuck. These cells are the gametocytes, a.k.a. oocytes in women, and spermatocytes in men, which do not duplicate unless they get fertilized. But by then the virus is no longer active. It's literally stuck, in the sense that the integrated viral DNA now cannot replicate and cannot escape the host's DNA. It's just a bit of non-functional DNA that gets duplicated along as the embryo grows. The new individual now carries the viral genes in every cell of his/her body, even in the gametocytes, and hence the viral genes will be inherited by future generations as well.

And that's how viruses ended up in our genome a long, long time ago and have literally become "evolutionary fossils." In fact, by looking at these endogenous retroviral sequences, scientists are able to reconstruct the evolution of ancient viruses.

References

[1] Legendre, M., Bartoli, J., Shmakova, L., Jeudy, S., Labadie, K., Adrait, A., Lescot, M., Poirot, O., Bertaux, L., Bruley, C., Coute, Y., Rivkina, E., Abergel, C., & Claverie, J. (2014). Thirty-thousand-year-old distant relative of giant icosahedral DNA viruses with a pandoravirus morphology Proceedings of the National Academy of Sciences, 111 (11), 4274-4279 DOI: 10.1073/pnas.1320670111

[2] Emerman M, & Malik HS (2010). Paleovirology--modern consequences of ancient viruses. PLoS biology, 8 (2) PMID: 20161719

[3] Dunlap KA, Palmarini M, Varela M, Burghardt RC, Hayashi K, Farmer JL, & Spencer TE (2006). Endogenous retroviruses regulate periimplantation placental growth and differentiation. Proceedings of the National Academy of Sciences of the United States of America, 103 (39), 14390-5 PMID: 16980413

[4] Dupressoir A, & Heidmann T (2011). [Syncytins - retroviral envelope genes captured for the benefit of placental development]. Medecine sciences : M/S, 27 (2), 163-9 PMID: 21382324

Ice caps melt, prehistoric virus escapes. No, it's not a movie.

Last week I talked about the connection between global warming and the Zika virus. This week I'll discuss another interesting side effect we might observe in the next decade thanks to global warming. The ice caps will melt. Big deal, we already knew that. But have you ever thought of the stuff trapped in that ice that's going to thaw? What if some of that stuff isn't really dead, just dormant, waiting to come back? Sounds like fiction, but it's not.

Up until a few years ago the general notion was that viruses were small. How small? Let's think in terms of genome units: viruses usually carry a handful of genes, either coded into DNA or RNA, and you can think of these as longs strings of four letters: A,C,T (or U if it's RNA), or G. The letters are called nucleotides, and the genome of most common viruses is typically in the order of tens of thousands of nucleotides long. By comparison, the human genome, with its 3 billion nucleotides, is enormous.

The notion of viruses being "small" compared to living cells was turned upside down with the discovery of megaviruses in 2010 (over one million bases) and, in 2013, of the pandoraviruses, a family of viruses that can reach a staggering 2.5 million bases in genome size.

Before you freak out: so far these gigantic viruses have only been found in unicellular organisms called amoebas, not in humans or any other animals. Amoebas acquire their nutrients through phagocytosis and that's also how the gigantic viruses infect them: the cell membrane forms a vesicle around the particle and engulfs it.

The two specimens of pandoraviruses were found in shallow water sediments, one in Chile and the other one in Australia. They were both so big that they could be visible by optical microscopy, reaching 1 μm in length and 0.5 μm in diameter. Now to the interesting bit: the researchers found over 2,000 genes in these pandoraviruses, of which over 90% looked nothing like any other previously known gene. In fact, they appear to be unrelated to the previously discovered megaviruses. So what are they? A fourth domain of life? A completely isolated niche in the tree of life? Or could they be -- as the sci-fi writer in me wants to think -- the remnants of a completely different form of life, one that existed so long ago that these gigantic particles are all there is left of it?

Ok, I thought I was original when I posed that question, but I wasn't. The researchers who'd first discovered the pandoraviruses wondered about the exact same thing and, in order to find an answer, they went digging through fossils. They found a giant virus (which they named pithovirus) in a sample of Siberian permafrost radiocarbon dated to be over 30,000 years old. And I have to say, they beat me in sci-fi imagination because they go as far as to claim that there may be more gigantic viruses frozen out there that could be released from the ice as global warming takes over. *Insert apocalyptic soundtrack here*

The researchers took a sample of Siberian permafrost layer (corresponding to late Pleistocene sediments older than 30,000 years) and used it to inoculate a particular culture of amoebas (called Acanthamoeba castellanii). Lo and behold, they indeed observed particles of a prehistoric giant virus called pithovirus multiplying in the amoeba culture, making it the most ancient eukaryote-infecting DNA virus revived to date! The observed viral particles were amplified and examined through transmission electron microscopy and were found to have many similarities with the pandoraviruses, only they were even bigger. Contrary to pandoraviruses, though, these pithoviruses showed many more similarities to present-day viruses that normally infect humans and animals. This prompted the researchers to raise the alarm:

"Our results further substantiate the possibility that infectious viral pathogens might be released from ancient permafrost layers exposed by thawing, mining, or drilling. Climate change in the Russian Arctic is more evident than in many other regions of the world. Whereas the average global temperature has increased by 0.7 °C during the last 100 y, the average temperatures of the surface layer of Arctic permafrost have increased by 3 °C during the same period."

As the authors themselves put it,

"This work is a reminder that our census of the microbial diversity is far from comprehensive and that some important clues about the fundamental nature of the relationship between the viral and the cellular world might still lie within unexplored environments."

Now, if you'll excuse me, I think I just got an idea for the next bestselling post-apocalyptic thriller.

Philippe, N., Legendre, M., Doutre, G., Coute, Y., Poirot, O., Lescot, M., Arslan, D., Seltzer, V., Bertaux, L., Bruley, C., Garin, J., Claverie, J., & Abergel, C. (2013). Pandoraviruses: Amoeba Viruses with Genomes Up to 2.5 Mb Reaching That of Parasitic Eukaryotes Science, 341 (6143), 281-286 DOI: 10.1126/science.1239181

Legendre, M., Bartoli, J., Shmakova, L., Jeudy, S., Labadie, K., Adrait, A., Lescot, M., Poirot, O., Bertaux, L., Bruley, C., Coute, Y., Rivkina, E., Abergel, C., & Claverie, J. (2014). Thirty-thousand-year-old distant relative of giant icosahedral DNA viruses with a pandoravirus morphology Proceedings of the National Academy of Sciences, 111 (11), 4274-4279 DOI: 10.1073/pnas.1320670111

The Zika outbreak: a wake-up call about climate change?

People are still talking about the Ebola virus and its deadly outbreak in West Africa, and now a new virus is making the headlines: Mostly innocuous and fairly unknown until a few weeks ago, the Zika virus is suddenly dominating the news. Under scrutiny is the virus's putative link with a congenital birth defect called microcephaly, which causes babies to be born with abnormally small heads and undeveloped brains.

Two recent publications [1,2] have documented finding the genome of the Zika virus in the amniotic fluid and brains of fetuses affected by microcephaly from three different mothers. These numbers are still too small to constitute a proof, and in fact, alternative explanations are already cropping up: an organization of Argentinean doctors has published a report in which they claim that it's not the virus, rather the insecticide used against the mosquitos, that causes the birth defect.

But what is Zika and, if the claims about microcephaly turn out to be true, how can it be harmless to most people yet so detrimental to a developing fetus? To answer these questions we have to take a step back and understand how viruses work and why some are endemic in the population, while others seem to come and go in waves.

The Zika virus was first isolated in 1947 from a rhesus monkey and from a pool of mosquitos in the Zika forest in Uganda. It belongs to the same family of viruses as dengue, yellow fever, and West Nile virus. However, unlike its close relatives, Zika was thought to be relatively harmless: most infected people experience no symptoms and a few have just a rash and mild fever. Originally confined to Africa, Zika started expanding to Asia in 2007. Since then the virus has spread exponentially.

Viruses like Zika are similar to Ebola in that they replicate in animal populations, where they are endemic. Ebola, for example, usually infects bats and jumps to humans who consume meat from infected animals. Zika is found in monkeys, and both monkeys and humans contract it through bites from mosquito carriers. To evade the host's immune system, viruses evolve continuously: as organisms build immunity to fight them off, genetic changes enable viruses to escape the newly made defenses.

Most of the people who contract Zika don't even realize they've been infected. They might just notice a pesky mosquito bite. But that pesky bite hints at the virus's covert strength: once inside the mosquito, the virus becomes an invisible enemy, one that hides and migrates through a tiny insect. You can avoid infected people when you see them sniffing and sneezing, but how do you avoid a symptomless agent that spreads through a flying bug?

You don't. In areas where these mosquitos flourish, children get infected early in life, build immunity against the virus, and don't worry about it ever again.

Then why is Zika posing a threat now?

The problem arises when the virus moves to a new geographical area and encounters a population that has never been infected before. Pregnant women are particularly at risk: unless they've been infected earlier in life, in which case their immune system can clear the infection before it reaches the fetus, any disease agent that has the ability to cross the placenta is a potential threat. That's true of Zika. Despite its normally mild symptoms, when it reaches the completely naïve immune system of a fetus in the early stages of pregnancy it can potentially cause permanent damage.

Although the connection between microcephaly and Zika has yet to be confirmed, Los Alamos National Laboratory virologist and epidemiologist Brian Foley does not believe that pesticides are responsible, as hinted by the Argentinean report.

"Of course the insecticide application is slightly correlated," Foley says, "because Zika, dengue, and other similar viruses are spread by mosquitoes. So, wherever you find one, you'll find the other, too. The insecticide mentioned in the Argentinean report has been in use since before 2000 and was heavily tested for mammalian toxicity before being put into use. And it is used all over the world for mosquito control, not just in Argentina and Brazil."

"We can't exclude that Zika is responsible for microcephaly in areas where it has circulated longer. To detect such links takes careful reporting and record keeping, and most countries do not have really accurate reporting to a central database."

The truth is, both the insecticide use and the virus are consequences of a global trend: over the past two decades, vector-borne viruses like Zika and yellow fever have spread globally at an increased rate. Why? That human behavior is once again responsible for this new spread comes as no surprise. Increased traveling between continents, a rapidly growing population and, last but not least, a rise in temperatures have created the perfect conditions for mosquitos--and hence the diseases they carry--to spread virtually unstopped. Humid, densely populated areas riddled with stagnant water become the ideal habitat for these bugs.

The race for a vaccine has started, and several companies have already announced a schedule to begin human trials in the near future. Unlike HIV, for which making a vaccine has turned out much more challenging than originally anticipated, the genome of the Zika virus is not very diverse. However, making any vaccine is regulated by strict government safety rules that require years of testing. "Under normal circumstances, it takes 10-20 years to make a vaccine," Foley explains. "In an emergency situation, they could push it to two to four years. That's still a long time in the event of an outbreak."

It's even longer if you think that Zika may only be the tip of the iceberg of a phenomenon we are bound to see over and over again in the near future.

"The distribution, transmission, and abundance of vectors that bear and transmit diseases are being enhanced by global warming," Foley and colleagues state in a recent publication [3]. "The mean global temperature increased approximately by 1 degree centigrade during the last several hundred years. However, during the next 20 years it is anticipated to increase by 2 to 3 degrees centigrade."

Geographic areas once too cold for mosquito-borne diseases are now seeing an increase in encephalitic viruses, dengue, and West Nile. Similarly, Zimbabwe and Ethiopia are experiencing an increase in typhoid and cholera due to poor hygiene, stagnant water and climate change.

So yes, a vaccine can provide a solution. But if this is only the beginning, we need to think globally. It's not just one virus we're fighting but a global change that's happening too fast for the natural world to adapt on its own.

Elena E. Giorgi is a computational biologist in the Theoretical Division (Theoretical Biology group) at Los Alamos National Laboratory and the author of the science fiction thrillers Chimeras, Mosaics, and Gene Cards. This content was reviewed by Los Alamos National Laboratory and approved for release under LA-UR 16-20983. For more information, please contact the Los Alamos National Laboratory Communication Office.

References
[1] Mlakar J, Korva M, Tul N, Popović M, Poljšak-Prijatelj M, Mraz J, Kolenc M, Resman Rus K, Vesnaver Vipotnik T, Fabjan Vodušek V, Vizjak A, Pižem J, Petrovec M, Avšič Županc T. N Engl J Med. 2016 Feb 10. Zika Virus Associated with Microcephaly. PMID: 26862926

[2] A. S. Oliveira Melo, G. Malinger, R. Ximenes, P. O. Szejnfeld, S. Alves Sampaio andA. M. Bispo de Filippis. Zika virus intrauterine infection causes fetal brain abnormality and microcephaly: tip of the iceberg? Ultrasound in Obstetrics & Gynecology. Vol 47 Issue 1. DOI: 10.1002/uog.15831

[3] Paul Shapshak , Charurut Somboonwit, Brian T. Foley, Sally F. Alrabaa, Todd Wills, John T. Sinnott (2015). Zika Virus. Global Virology I - Identifying and Investigating Viral Diseases Springer-Verlag

The fossils hidden in our genome: geneticists turn into archeologists ... sort of.

I often blog about viruses because, well, I work on viruses. Here's a quick summary of things I've blogged about that I find absolutely mind-blowing:

1. About 10% of the human genome is made of genes we inherited from viruses that had replicated in our ancestors millions of years ago.

2. Viruses evolve as their hosts evolve (The Red Queen Effect), and in fact we can retrace their evolution in parallel with that of their hosts. The same is true within a single host, enabling us to retrace the evolution of a single virus in parallel with that of the host's antibodies.

3. Genes expressed by viruses and bacteria in our body can affect our phenotype.

4. We can use the ability of viruses to target certain cells to devise new cancer therapies.

5. We can use viruses to edit the genome of certain cells and cure genetic defects through gene therapy.

So yes, viruses are cool and they play a huge role in evolution. The fact that roughly 10% of our genome is made of viral elements (called human endogenous retroviruses, or HERVs) makes our DNA a "living fossil": these are viruses that infected our ancestors millions of years ago. Retroviruses in particular insert their genome inside the cell's DNA in order to replicate. In some instances, these viral genomes got stuck inside germ line cells and that's how they got passed on to the host's offspring and became part of our DNA.

Today these viruses are extinct, as they evolved into new forms, but by investigating the inactivated genes they left in our genome, researchers can find out what they looked like millions of years ago. It's like digging out fossils in our own cells.

It's exactly what two scientists from The Rockefeller University did with one family of HERVs in particular, HERV-K(HML-2) believed to have replicated in human ancestors less than one million years ago (making it one of the most recent forms found in the human genome). They looked at several of these genes across different subjects and reconstructed a "consensus genome", in other words, a genetic sequence that at each DNA position had the nucleotide most frequently found across all study subjects.

For example, if the samples across all subjects looked something like this, with the differences, highlighted in red (made up sequences!!):

then the consensus sequence would be one of the sequences without red mutations because they represent the majority, in other words:

GATACTTGGACAGGAGTTGAAGCTATAATAAGAATTCTACAACAACTGCT

Back to the HERV study, which was published in PLoS Pathogens in 2007, Lee and Bieniasz recreated the HERV-K consensus from ten full-length HERV-K(HML-2) sequences and then reconstituted the virus in the laboratory. The ten sequences were selected based on their similarity to HERV-K113, a relatively young and intact HERV-K provirus. While all ten sequences had defects that made viral genes inactivated, selecting the most frequent base at each position, eliminated these defects and yielded a full genome sequence (the consensus) with intact proteins. This derived consensus sequence may not be 100% identical to the actual virus that was integrated into the human genome close to a million of years ago, but it's pretty close. This "closeness" was confirmed in the lab when the scientists saw that the virus they reconstructed based on the consensus genome was indeed able to infect T cells in vitro. All proteins of the reconstructed virus were functional and able to carry one the virus's replication cycle.

It's like Jurassic Park... for viruses. :-)

Lee, Y., & Bieniasz, P. (2007). Reconstitution of an Infectious Human Endogenous Retrovirus PLoS Pathogens, 3 (1) DOI: 10.1371/journal.ppat.0030010

How one vaccine can protect you from more than one disease

The paper I'm discussing today came out last May in Science but, as you probably noticed, I've been busy posting about other things and neglected the science aspect of the CHIMERAS blog. Apologies to my science readers.

Viruses are pesky little things that have the innate ability of inserting genetic material into our cells. As such, they are capable of permanently changing our immune system: for one thing, our immune system learns to recognize the pathogen and that "memory" will be used to prevent future infections. Viruses can also alter the expression of certain genes within the infected cells, shutting off the production of proteins that would otherwise prevent the virus from replicating.

Viruses that infect preferentially cells from the immune system are particularly nasty. HIV, for example, gradually depletes the host's reservoir of T-cells (the "sentinels" of the immune system) until patients die of a common infection simply because their body can no longer fight pathogens.

HIV is not the only virus that attacks the immune system. Measles is another one. The virus enters cells through a receptor that's expressed on the surface of many immune cells such as dendritic cells, macrophages, and lymphocytes. All of these cells have a very important function: they retain "immune memory." What does it mean? Every time the immune system encounters a new pathogen (a virus, a bacterium, etc.), bits of proteins from the pathogens are presented to the immune cells. The immune cells create an "impression" of these proteins so that they can bind to them and destroy them. using a metaphor, they create a "mold", a special receptor that binds to the pathogen. Lots of cells with the special "mold" are created, so they can bind to the pathogen, capture it, and destroy it. A whole army of cells needs to be created in order to get rid of the million viral particles in the body, but once the infection is over and the full army is no longer needed, only a few of these cells with the special "mold" are saved. These few are the ones that preserve the memory of the specific pathogen, so that next time it enters the body it is recognized immediately and destroyed before it can start the infection.

Back to the measles virus. This nasty pathogen has a special receptor that allows it to enter the cell membrane of "mature" immune cells [1], i.e. cells that carry that special "mold" for a particular pathogen. By infecting and killing those cells, the measles virus effectively erases immune memory, making the host prone to be reinfected by pathogens it has already encountered. So, on the one hand, the virus stimulates immune responses that will protect from future measles infections. On the other hand, however, it erases some of the existing defenses against other pathogens. It's called the "measles paradox." Immune memory of previous pathogens is eared and replaced by measles-specific immune responses. [2]

A study published in Science last May [3] corroborated this finding by looking at child mortality data from England, Wales, the United States, and Denmark during the decades immediately preceding and following the introduction of the measles vaccine. The researchers showed that immune memory loss caused by measles infection lasted from 6 months to several years, and that vaccination against measles significantly reduced child mortality caused by non measles infections.

To further corroborate their analysis, the researchers applied the same techniques to pertussis, which is also known to cause immunosuppression. This time they found no correlation with the incidence of pertussis and non-pertussis infectious disease mortality, corroborating the hypothesis that it was the measles vaccine to cause the drop in mortality.

"MV infection and vaccination produce strong and durable herd immunity against subsequent epidemics. Our results thus suggest an extra dynamical twist: MV infections could also reduce population immunity against other infections in which MV immunomodulation could be envisioned as a measles-induced immune amnesia; hence, measles vaccination might also be preserving herd protection against nonmeasles infections [3]."
<\blockquote>

[1] Tahara, M., Takeda, M., Shirogane, Y., Hashiguchi, T., Ohno, S., & Yanagi, Y. (2008). Measles Virus Infects both Polarized Epithelial and Immune Cells by Using Distinctive Receptor-Binding Sites on Its Hemagglutinin Journal of Virology, 82 (9), 4630-4637 DOI: 10.1128/JVI.02691-07

[2] de Vries, R., & de Swart, R. (2014). Measles Immune Suppression: Functional Impairment or Numbers Game? PLoS Pathogens, 10 (12) DOI: 10.1371/journal.ppat.1004482

[3] Mina MJ, Metcalf CJ, de Swart RL, Osterhaus AD, & Grenfell BT (2015). Long-term measles-induced immunomodulation increases overall childhood infectious disease mortality. Science (New York, N.Y.), 348 (6235), 694-9 PMID: 25954009

So you're afraid of vaccines. Why don't we take a look at how they actually work?

March Moonrise, ©EEG

A few days ago a 4-year-old child died in a hospital in Rome, Italy. She had contracted Dawson encephalitis, a rare and chronic form of brain inflammation which is a complication from the measles virus. No, the child had not been vaccinated. Last February, an 18-month-old toddler also died of measles, this time in Germany.

Back when the smallpox was killing and blinding people, parents didn't have to choose whether or not to vaccinate their children. The choice back then was to whether or not expose the children to pus from an infected person's pustules or let them get the disease from natural exposure. People still contracted the disease through this primitive form of inoculation, yet the risk of dying was far less. So that's what parents did back then. Can you imagine purposely exposing your child to a deadly and impairing disease just because the chance of dying from it was so high anyways? Don't you feel privileged that you don't have to make that kind of decision for your own children?

People say vaccines are not natural. Yet when your own child gets sick and his/her fever spikes, you don't think twice about giving them ibuprofen or whatever medication it takes to lower the fever. That's because the consequences could be devastating. Yet ibuprofen is not natural. You don't normally find it in the body, and prolonged consumption has serious consequences on the liver.

Viruses, on the other hand, are natural. They are so natural that bits of viruses are embedded in our own DNA. Back when a smallpox vaccine didn't exist, parents who smeared pus from smallpox pustules on their healthy children were causing the body to make immune memory. That's because once the immune system "recognizes" the virus it can build a response strong enough to destroy the pathogen before it can start the infection. But the immune system has to "see" the virus for the first time in order to recognize it. That's why people who survived the infection never got it again. The principle is simple and completely natural. The risk was very high, though: pustules from infected people contained live virus, and many died in the attempt to avoid the disease.

Today we have a beautiful, safe way to create immune memory without having to go through the actual infection. We take little bits of chopped virus and put it inside the body. The chopped up virus can't cause the infection because it's missing some of its part. At the same time the immune system learns to recognize those extraneous proteins and builds immune memory.

So, you see, you can watch your child get sick and load him/her with drugs and medicine on top of risking serious complications. Or you can take him/her to the doctor and have them take a shot. One shot at the time, you don't have to load up in one sitting if that's what concerns you. At the end of the day, both the child who got sick and the vaccinated child will have built immune memory. But one has gone through days of fever, pain, and medications. The other one just got a shot.

So what's more natural to you?

And no, I have no financial gain from telling you this. I get my salary whether or not you get a shot. In fact, if you think about it, it's the unvaccinated child that's causing more of an economic burden right now. And whenever there's an economic burden, it means somebody is making a financial gain out of it. So, if nothing else, I'd say it's the parents who opt out of vaccinations who are financially manipulated.

But that's just me. What do I know? All I know is that a 4-year-old died. And in the twenty-first century no child should die of a complication from the measles virus.

Extinction Edge: a new thriller on how epigenetic changes induced by viruses could kill us all

Today my friend Nicholas Sansbury Smith releases Extinction Edge, the sequel to Extinction Horizon, a sci-fi thriller where humanity is driven to extinction by a lethal virus. I posted an interview with Nick for the release of his first book, but today I wanted to talk about the science behind his premise: can a virus induce epigenetic changes?

In a way, Nick's premise is similar to the premise I used in Chimeras: a large part of our DNA is made of pseudogenes, which are ancient genes that are no longer coding for proteins. They are "fossils" in a way, remnants of our evolutionary history. In very layman terms: new species evolve from old ones not because old genes are replaced, rather, new gene copies arise, then mutations accumulate and differentiate the new genes from the old ones, until the old genes are silenced and the new ones take over.

The part that tickles a writer's imagination is the following: if we still have all these ancient genes that once made our ancestors predators and hunters, could we possibly activate them and have people regress back to those ancient states?

If you've read Chimeras, you know how I made it happen in my detective Track Presius, and if you've read Extinction Horizon you know how Nick answered the question in his book. We both use a virus, though not the same one. A virus that "awakens" non-coding genes... is that completely far-fetched?

Turns out, it's not. Of course, it highly depends on what genes we want to awaken.

Epigenetics studies the mechanisms that turn genes "on" and "off" (i.e. expressed or not), how they are affected by the environment, and how they can be inherited from one generation to the next without being encoded in the DNA itself. One of such mechanisms that alters gene expression is DNA methylation, the addition of a methyl group to one of the A or C nucleotides in the DNA. Several studies have looked at how viruses can alter our epigenome, some in a permanent way.

Viruses insert their genes inside the host cell and hijack the cell's own proteins in order to replicate. The cell, on the other hand, defends itself by trying to silence the viral genes through a series of epigenetic mechanisms. So of course viral infections and epigenetic changes go hand in hand. I'm sure that these virally induced epigenetic changes can affect us in many subtle ways, and the vast majority of these changes leave us unharmed. However, when you search the literature, you find mostly studies that have looked at viruses that are associated with tumorigenesis because clearly that's of great interest to the medical field: viruses are much easier to detect early than tumors, and if we can understand the mechanisms they use to trigger cancer, then we can also prevent them from establishing the disease.

For example, the Epstein-Barr virus causes mononucleosis but it's also associated to some types of cancers, especially in immuno-suppressed individuals such as AIDS patients. As it turns out, the virus alters genome-wide gene expression in infected cells and these alterations can be pre-cancerous [1] (meaning the affected cells have a higher chance to accumulate tumorigenic mutations). Another virus that induces pre-cancerous epigenetic changes in liver cells is hepatitis, both the B and C kind [2, 3], which lead to liver carcinoma in about 10% of the infected individuals.

Epigenetic changes have been studied in HIV infected cells, too. People infected with HIV have to take a cocktail of antiretroviral medications for life and, despite the regimen, they never completely get rid of the virus. This is because the virus inserts its genome inside cells and then some of these cells become latently infected. They do not produce virions for months, sometimes years. However, as soon as the patient stops the antiretroviral therapy, the virus suddenly "awakens" and starts spreading throughout the body. These latently infected cells form a "reservoir" and how to get rid of it has been the focus of many studies lately as it is one of the major obstacles preventing us from finding a cure for AIDS. In this review [4], Mbonye and Karn explain how provirions (the HIV genes inserted inside the host cell genome) become latent through epigenetic mechanisms that silence them.

Studying epigenetic changes induced by viral infections is a relatively new field, but one that is very promising because contrary to genetic changes, epigenetic alterations are reversible. So, if we can find the viral triggers that lead to pathogenesis we have a potential preventive therapy by reversing those mechanisms.

Extinction Edge by Nicholas Sansbury Smith: Survivors call them Variants. Irreversible epigenetic changes have transformed them into predators unlike any the human race has ever seen. And they are evolving. A bioweapon designed to save the world, a scientific discovery that will alter human history, and a new threat that will bring humanity to the edge of extinction.

Chimeras by E.E. Giorgi: Haunted by the girl he couldn't save in his youth, and the murder he committed to avenge her, Detective Track Presius has a unique gift: the vision and sense of smell of a predator. When a series of apparently unrelated murders reel him into the depths of genetic research, Track feels more than a call to duty. For Track, saving the innocent becomes a quest for redemption. The only way he can come to terms with his dark past is to understand his true nature.

[1] Birdwell CE, Queen KJ, Kilgore PC, Rollyson P, Trutschl M, Cvek U, & Scott RS (2014). Genome-wide DNA methylation as an epigenetic consequence of Epstein-Barr virus infection of immortalized keratinocytes. Journal of virology, 88 (19), 11442-58 PMID: 25056883

[2] Tian Y, Yang W, Song J, Wu Y, & Ni B (2013). Hepatitis B virus X protein-induced aberrant epigenetic modifications contributing to human hepatocellular carcinoma pathogenesis. Molecular and cellular biology, 33 (15), 2810-6 PMID: 23716588


[3] Rongrui L, Na H, Zongfang L, Fanpu J, & Shiwen J (2014). Epigenetic mechanism involved in the HBV/HCV-related hepatocellular carcinoma tumorigenesis. Current pharmaceutical design, 20 (11), 1715-25 PMID: 23888939

[4]Mbonye U, & Karn J (2011). Control of HIV latency by epigenetic and non-epigenetic mechanisms. Current HIV research, 9 (8), 554-67 PMID: 22211660

Eight things you should know about viruses

http://visual-science.com/projects/hiv/illustrations/

Today I'm a guest blogger over at Dan Koboldt's "Science in Sci-fi, Fact in Fantasy" blog. Dan is an author and a geneticist and he has a wonderful series of posts written by experts in all fields, from horses to bow-hunting, from computers to genetics, teasing fact from fiction specifically for writers who want to use these topics in their books.

My post is -- surprise, surprise -- is about viruses: 8 things you should know about viruses. Check it out and if you are a writer, subscribe to Dan'd blog, you won't regret it!

The viruses inside us: can endogenous retroviruses elicit antibodies?

January Moonrise © EEG

Today I would like to discuss a couple of papers that I used as premise for my new thriller Immunity, which will be part of the Apocalypse Weird series, created by Nick Cole, Michael Bunker and Tim Grahl. Just like all my other thrillers, Immunity too, finds its roots in some fascinating facts about genetics, virology and of course immunity.

The premise of the book has to do with something I discussed a long time ago, in one of my very first posts: human endogenous retroviruses, or HERV's, are small portions of our DNA that we acquired from ancient retroviruses that infected germ line cells of our primate ancestors. Basically, these genes came directly from retroviruses that inserted themselves into cells that then became oocytes or spermatozoa and, once fertilized, passed the viral genes to a new individual. These genomic elements are mostly inactivated in adults (meaning they are in a non-coding part of the DNA), but they have been shown to be transcriptionally active during fetal development. The intriguing bit, however, is that expression levels of these genetic elements have been found to be disrupted in subjects with schizophrenia [1].

I'm sure you are all familiar with the disease, which typically manifests itself through hallucinations (mostly auditory ones), delusions, and the inability to distinguish reality from things that only exists in the patient's mind. It's often characterized also by disorganized thoughts and incoherent speech. Nobel laureate John Nash suffered from schizophrenia, and his disease was portrayed in the movie A Beautiful Mind, though in a very fictionalized way. Another famous case is USC professor Elyn Saks, who wrote an award-winning memoir on her life-long battle against schizophrenia.

Retroviruses are sleek little things. They can infect brain cells and integrate their genomes into the host cell's DNA, causing all sorts of damage. For example, some studies have shown that viruses like HIV and HTLV can indeed infect the brain, causing symptoms such as psychosis and depression [2]. The body fights viruses and pathogens by sending its sentinels (natural killer cells, T cells and antibodies) to find them and destroy them. But what happens if the virus is already embedded in our genome, as is the case with HERVs? Those viral elements have been part of our genome for millions of years, so, in theory, our immune system is not supposed to 'see' them.

 One of the most marvelous and yet most delicate mechanisms that is at the foundation of our immune system is its ability to distinguish self from non-self. T cells and B cells have to undergo strict scrutiny to make sure that they don't mistakenly attack cells of our own body thinking that they are pathogens. This mechanism is tough but not perfect, and failures to recognize self from non-self are at the basis of numerous auto-immune disorders. Autoimmune thyroditis, for example, is an inflammation of the thyroid caused by antibodies attacking the thyroid.

One natural hypothesis as to why HERVs expression levels could be disrupted in a disease like schizophrenia could be that the body is producing antibodies against those genetic elements. This hypothesis cannot be tested directly because, as Dickerson et al. explain in [1], there are no available reagents. However, one can look for antibodies that recognize retroviruses like murine leukemia virus (MuLV), Mason-Pfizer monkey virus (MPMV), and feline immunodeficiency virus (FIV) because they have enough similarities with HERVs.

Dickerson et al. measured the levels of antibodies against these viruses in a population of 666 study subjects, of which 163 with a recent onset of psychosis, 268 with multi-episode schizophrenia, not of recent onset, and 235 controls without a history of psychiatric disorders. They found a significant increase in antibody levels in the recent onset group compared to controls, but not in the multi-episode group compared to controls. At the same time, these subjects had no traces of the actual viruses in their bodies, indicating that the antibody response had to be elicited by the endogenous elements (instead of an active infection). Another study [2] looked for an enzyme called reverse transcriptase, which is a marker for retroviral activity, and found that it was 4 times higher in the cerebrospinal fluid of patients with recent onset of schizophrenia compared to controls.

Many autoimmune disorders are caused by the immune system suddenly attacking its own self. I've used this premise before in my books: Track Presius, the main character in Chimeras, has elevated levels of anti-nuclear antibodies, which are antibodies that, in high concentrations, can cause different immunological disorders as they tend to bind to human antigens.

What intrigued me about the HERV-schizophrenia association, though, was: the researchers tested the presence of antibodies against HERV's using viruses that are not commonly found. What if, instead, a common virus like the flu did bear resemblance to the HERV elements in our brain? In order to fight the infection, our body would have to start producing antibodies that could potentially attack those human genes, too. What would then happen to the brain, suddenly under attack by its own antibodies?

I don't know the real answer, but I can tell you that I had fun speculating about it in my novel. Immunity will be released in April and it will be part of the Apocalypse Weird series.

[1] Dickerson F, Lillehoj E, Stallings C, Wiley M, Origoni A, Vaughan C, Khushalani S, Sabunciyan S, & Yolken R (2012). Antibodies to retroviruses in recent onset psychosis and multi-episode schizophrenia. Schizophrenia research, 138 (2-3), 198-205 PMID: 22542615

[2] Yolken R (2004). Viruses and schizophrenia: a focus on herpes simplex virus. Herpes : the journal of the IHMF, 11 Suppl 2 PMID: 15319094

Ebola could mutate as rapidly as the flu

© Science Magazine

The largest genomic data collected on the Ebola virus to date has been recently published in Science [1], giving unique insights on the origin and spread of the greatest Ebola outbreak so far.

The Ebola virus was first discovered in 1976, when it caused 318 cases: until now, it was the largest outbreak.

"The current outbreak started in February 2014 in Guinea, West Africa, and spread into Liberia in March, Sierra Leone in May, and Nigeria in late July. It is the largest known EVD outbreak and is expanding exponentially [1]."

In a recent Science paper [1], researchers sequenced 99 Ebola genomes from 78 patients from Sierra Leone. By analyzing the genetic make-up of the viral population, scientists can retrace the spread of the outbreak. It's a bit like looking at the DNA of a large group of people to find out who's related to whom. In the case of Ebola, we want to know if there was only one "parent", so to speak, or if there were several animal-to-human reinsertions.

According to the paper, the event that brought the virus to Sierra Leone at the end of May was the burial of a healer from Guinea who had treated Ebola patients. Local practices at funerals include touching and kissing the corpse, and given that Ebola can survive in a dead host for up to three days, you can see how a single funeral can infect dozens of people, especially when the dead is a popular healer as in this particular case. Thirteen cases were traced back to this funeral, two of which stemmed the outbreak in Sierra Leone.

The researchers analyzed the viral genomes using phylogenetic trees, a technique that enabled them to retrace the history of the virus.

"Phylogenetic comparison to all 20 genomes from earlier outbreaks suggests that the 2014 West African virus likely spread from central Africa within the past decade [1]."

They were able to see that the "ancestor" originated from a single transmission event back in February. This finding contradicts previous hypothesis that the unprecedented spread of the outbreak was due to multiple transmission events from animal to humans. Contrary to this hypothesis, after that first transmission, in which the virus jumped from animals to human back in February, Ebola has been spreading among people alone.

"Genetic similarity across the sequenced 2014 samples suggests a single transmission from the natural reservoir, followed by human-to-human transmission during the outbreak. Molecular dating places the common ancestor of all sequenced Guinea and Sierra Leone lineages around late February 2014, 3 months after the earliest suspected cases in Guinea; this coalescence would be unlikely had there been multiple transmissions from the natural reservoir [1]."

But the most interesting point (to me at least) that the paper addresses is the virus's mutation rate. Since viruses replicate quite rapidly, it's important to know how high is the chance that at every replication cycle, errors (i.e. mutations) are introduced. Rapidly mutating viruses have a greater chance to escape the immune system (see HIV, for example) and are also much harder to target with a vaccine. The Science paper claims that

"The observed substitution rate is roughly twice as high within the 2014 outbreak as between outbreaks [1]."

In fact, they estimate the mutation rate to be roughly the same as that of the seasonal flu, which, if confirmed, would greatly hamper the creation of a vaccine.

Unfortunately the odds are still against poor countries. I attended a talk this week where the speaker reported that while the mortality rate in the affected African countries is at 95%, in the Western world it drops down to 75-80%. This is due to prompt intervention, the use of serum from people who survived the infection (and hence developed good antibodies against the virus), and the use of IVs. Unfortunately, people living in the affected countries tend to be skeptical of westerners and, just like it happened with HIV, beliefs that Ebola is yet another virus introduced by Westerners to hurt the locals are rampant.

When I finished reading the Science paper, I was saddened to find this final paragraph:

"In memoriam: Tragically, five co-authors, who contributed greatly to public health and re- search efforts in Sierra Leone, contracted EVD and lost their battle with the disease before this manuscript could be published: Mohamed Fullah, Mbalu Fonnie, Alex Moigboi, Alice Kovoma, and S. Humarr Khan. We wish to honor their memory."

[1] Gire SK, Goba A, Andersen KG, Sealfon RS, Park DJ, Kanneh L, Jalloh S, Momoh M, Fullah M, Dudas G, Wohl S, Moses LM, Yozwiak NL, Winnicki S, Matranga CB, Malboeuf CM, Qu J, Gladden AD, Schaffner SF, Yang X, Jiang PP, Nekoui M, Colubri A, Coomber MR, Fonnie M, Moigboi A, Gbakie M, Kamara FK, Tucker V, Konuwa E, Saffa S, Sellu J, Jalloh AA, Kovoma A, Koninga J, Mustapha I, Kargbo K, Foday M, Yillah M, Kanneh F, Robert W, Massally JL, Chapman SB, Bochicchio J, Murphy C, Nusbaum C, Young S, Birren BW, Grant DS, Scheiffelin JS, Lander ES, Happi C, Gevao SM, Gnirke A, Rambaut A, Garry RF, Khan SH, & Sabeti PC (2014). Genomic surveillance elucidates Ebola virus origin and transmission during the 2014 outbreak. Science (New York, N.Y.), 345 (6202), 1369-72 PMID: 25214632

Tweet

Ten years into the making, the HIV-1 mosaic vaccine finally goes into human trial

© Bette Korber et al.

I hope you will all forgive me if this week I'm gushing over my amazing mentor Bette Korber, as last week she shared some awesome news on Facebook:

"A landmark in my life happened yesterday, a major step in a long story. A decade ago I had an idea for making an HIV vaccine that had the potential to work globally. After a struggle (in my first 2 failed proposals, reviewers declared what I proposed was impossible), I got an internal grant from Los Alamos to develop the idea (third time's a charm). With that funding I could bring together a group of computational people to work together on expressing the idea -- a talented guy named Simon Perkins wrote amazing code to make it so, with computational design suggestions from the group, particularly my husband James Theiler. Then James, Will Fischer, Tanmoy Bhattacharya, and I put it through its paces, optimizing running conditions and devising ways to compare mosaics with natural proteins, with additional help from our friends Karina Yusim, Carla Kuiken and Bob Funkhouser. We called it a mosaic vaccine.

After so many years of hard work, and with the collaboration of experimentalists at Harvard and at Duke (Drs. Haynes, Letvin, and Barouch), two weeks ago a phase I safety trial finally opened, and an HIV mosaic vaccine went into the arm of a human volunteer for the very first time. "Safety trial" means that this is just the first phase in testing the safety of the vaccine (I explained the three phases of human trials in this post). We will gather immune responses and we are hoping to see the same good results we saw in monkeys [2-5]. If all goes well, HIV mosaics are in the pipeline for 4 more human vaccine studies. I'm so excited about this study and so proud of my mentor.

When I explain to people the challenge we are facing when designing an HIV-1 vaccine, I usually make a very simplistic comparison with the flu virus. Influenza evolves from one season to the next, which is why every year we need a new flu shot. So, basically, the flu evolves into a new virus every year. Well, HIV evolves so rapidly that every person has a different virus. In our database alone we have half a million distinct HIV viral sequences: how can you vaccinate people against half a million different viruses?

In the past, successful vaccines against diseases like polio or the measles have been made by taking a real virus, inactivating it (for example, you just take one or two of its proteins, but not the whole virus, to ensure it loses its ability to infect cells), and then injecting it into the body. The immune system "sees" the viral proteins and initiates a response. The response is then "saved" into memory cells, which, next time they encounter the pathogen, will remember how to produce the right response that will promptly clear the virus before it can start an active infection.

So, as you can see, the problem with HIV is that the viral population is so diverse that no one virus found in nature will protect people from contracting the infection. How to bypass the obstacle, then? Bette's idea is to basically use a computer that mimics HIV's evolutionary mechanisms to create an in-silico virus [1], something I've discussed in this post. The algorithm takes as input a population of, say, 100 different HIV sequences, and then recombines them creating a new population of artificially constructed viral sequences. HIV viruses can naturally recombine when infecting the same cells, and what the algorithm does is mimic this mechanism making sure that after every recombination step the new sequence is still a viable and functional virus. The computer mimics this process, iterates it multiple times and then the best representative is selected as a potential vaccine.

The first caveat is: is this new, artificially constructed sequence a real virus? After all, it was never found in nature. It was created by a computer algorithm. It turns out that when reconstructed in a wet lab, the mosaic proteins are functional and viable.

The second hurdle was to prove that these artificially constructed sequences are safe to be used in a vaccine and that they do elicit protective responses against not just a few HIV viruses, but many, many HIV viruses -- enough to prevent infection. So, you get an idea of why the mosaic vaccine took 10 years from concept to the first human trial.

Animal studies [2-5] demonstrated that mosaic vaccines elicit good immune responses. In one study in particular [3], compared to controls, vaccinated monkeys required many more challenges to get infected (for a risk reduction of 80%), and once infected, they were able to control the viral load and survive the infection.

So, as Bette said, we are hopeful. Hopeful and excited!

[1] Fischer W, Perkins S, Theiler J, Bhattacharya T, Yusim K, Funkhouser R, Kuiken C, Haynes B, Letvin NL, Walker BD, Hahn BH, & Korber BT (2007). Polyvalent vaccines for optimal coverage of potential T-cell epitopes in global HIV-1 variants. Nature medicine, 13 (1), 100-6 PMID: 17187074

[2] Nkolola JP, Bricault CA, Cheung A, Shields J, Perry J, Kovacs JM, Giorgi E, van Winsen M, Apetri A, Brinkman-van der Linden EC, Chen B, Korber B, Seaman MS, & Barouch DH (2014). Characterization and immunogenicity of a novel mosaic M HIV-1 gp140 trimer. Journal of virology, 88 (17), 9538-52 PMID: 24965452

[3] Barouch DH, Stephenson KE, Borducchi EN, Smith K, Stanley K, McNally AG, Liu J, Abbink P, Maxfield LF, Seaman MS, Dugast AS, Alter G, Ferguson M, Li W, Earl PL, Moss B, Giorgi EE, Szinger JJ, Eller LA, Billings EA, Rao M, Tovanabutra S, Sanders-Buell E, Weijtens M, Pau MG, Schuitemaker H, Robb ML, Kim JH, Korber BT, & Michael NL (2013). Protective efficacy of a global HIV-1 mosaic vaccine against heterologous SHIV challenges in rhesus monkeys. Cell, 155 (3), 531-9 PMID: 24243013

[4] Santra S, Muldoon M, Watson S, Buzby A, Balachandran H, Carlson KR, Mach L, Kong WP, McKee K, Yang ZY, Rao SS, Mascola JR, Nabel GJ, Korber BT, & Letvin NL (2012). Breadth of cellular and humoral immune responses elicited in rhesus monkeys by multi-valent mosaic and consensus immunogens. Virology, 428 (2), 121-7 PMID: 22521913

[5] Barouch DH, O'Brien KL, Simmons NL, King SL, Abbink P, Maxfield LF, Sun YH, La Porte A, Riggs AM, Lynch DM, Clark SL, Backus K, Perry JR, Seaman MS, Carville A, Mansfield KG, Szinger JJ, Fischer W, Muldoon M, & Korber B (2010). Mosaic HIV-1 vaccines expand the breadth and depth of cellular immune responses in rhesus monkeys. Nature medicine, 16 (3), 319-23 PMID: 20173752

Is EV-D68 causing mysterious polio-like symptoms in children?

Bubble fun at the Santa Fe Renaissance Fair © EEG 

One of the twists in my latest book, Gene Cards, is an unknown pathogen threatening the fictional city of Liasis. I confess that when I came up with the idea I was a little nervous. My story is set in the future, and with all the state-of-the-art technology we already have, is it feasible to think that we will still deal with diseases without a known causative agent? The thing is, new viruses and new pathogens arise all the time. Take the flu, for example. Every time it jumps from one species to another, it has the potential to recombine in new strains and create a new virus. Influenza viruses are usually recognizable from their surface proteins, hemagglutinin and neuraminidase. But the point is that for as long as there are pathogen that thrive in animal reservoirs and then suddenly jump to humans, these pathogens could potentially lead to unknown organisms. And it's hard to test for something you don't know. Another issue with viruses is that they can "hide" in cells (like neurons) that are not accessible through standard test, making them harder to detect unless one resolves to invasive techniques.

One thing is to theorize that it's possible, and one thing is to find it's happening, as you can read in this post from TWiV:

"In February 2014 I wrote about children in California who developed a poliomyelitis-like paralysis, also called acute flaccid paralysis or AFP. However, the cause of this paralysis was not known. The CDC has released its study of these cases and concludes 'The etiology of AFP with anterior myelitis in the cases described in this report remains undetermined'."

The CDC report is available online, and perhaps the most striking quote is the following:

"Additional laboratory testing for infectious diseases conducted at the CDPH Viral and Rickettsial Disease Laboratory did not identify a causative agent to explain the observed clinical syndrome reported among the patients."

So, what is the story, here?

Acute flaccid paralysis happens when muscles become weak or limp and can no longer contract. In order to be diagnosed as AFP, the symptoms must arise spontaneously and not be caused by a trauma. A number of viruses can cause this condition, including polio. When caused by polio, the paralysis is associated with inflammation of the spinal cord, and the whole condition takes the name of "acute flaccid paralysis associated with anterior myelitis." A total of 23 cases of acute flaccid paralysis associated with anterior myelitis have been reported in California between June 2012 and May 2014.

"Affected patients resided in diverse geographic areas throughout California with no indication of clustering. During the 30-month inquiry, no indication of seasonality or temporal trends in disease onset was established."

Twelve patients had been vaccinated against polio, two hadn't, and for the rest no information was available. Nineteen of the 23 patients had been tested for the "usual suspects" (polio, enteroviruses, West Nile virus, rabies, etc.), but only two tested positive for Enterovirus EV-D68, which in most cases actually manifests as a respiratory disease. The CDC report excludes polio as a cause of the 23 cases in the study and concludes that no common etiology could be found.

[. . .] whether these cases represent an actual increase from baseline incidence of AFP with anterior myelitis in this population is unclear. A study examining AFP in children aged 15 years in California during 1992-1998 reported an incidence of 1.4 AFP cases per 100,000 children per year, with the most common diagnoses being Guillain-Barre syndrome (23%), unspecified AFP (21%), and botulism (12%). None of the 245 reviewed cases had recognized anterior myelitis, which is characteristic of paralytic poliomyelitis.

If you do a quick search on PubMed, you'll see that the most common etiology for AFP is polio, and in those cases it's usually associated with anterior myelitis. A Korean study carried over the span of 10 years (from 2001 to 2010) found a total of 285 AFP cases, for which Guillain-Barre syndrome was the major leading causes [1]. Usually triggered by an infection, Guillain-Barre syndrome is a disorder that affects the peripheral nervous system. With prompt treatment, it is 100% curable, though if not treated promptly, it can cause life-threatening complications.

What about the two patients who tested positive for Enterovirus D68? EV-D68 was first isolated in 1962. Since then, there have been rare reports of clustered cases, particularly in summer. However, this summer, there has been an unusual increase in reported cases of severe respiratory diseases, and most of these cases tested positive for EV-D68. Here are the latest numbers from the CDC:

"From mid-August to October 8, 2014, CDC or state public health laboratories have confirmed a total of 664 people in 45 states and the District of Columbia with respiratory illness caused by EV-D68."

What makes this virus worrisome is that it affects young children (usually under the age of 10) and that currently there is no vaccine or treatment against it. And while it normally manifests as a respiratory disease, in some rare instances, the virus can affect the nervous system. In the two California AFP cases that tested positive for EV-D68, the virus was found through nasal swabs. There is a possibility that in the other cases the virus was not found because it was elsewhere, namely in the nervous system (where it would be found only through invasive procedures).

In a different report, the CDC describes

"a cluster of nine children evaluated at Children's Hospital Colorado with acute neurologic illness characterized by extremity weakness, cranial nerve dysfunction (e.g., diplopia, facial droop, dysphagia, or dysarthria), or both. Neurologic illness onsets occurred during August 8‚ September 15, 2014."

Four of eight Colorado children tested were positive for EV-D68. And even though these symptoms are not quite equivalent to AFP, they still fall within the spectrum of acute neurologic illnesses.

Bottom line: we can't quite hold EV-D68 as responsible of the mysterious AFP cases, but we can't exclude it either. Viruses tend to target specific cells in the body, and sometimes they can spread beyond their usual "hunting grounds." When a pathogen is symptomatic (or manifests certain symptoms) only in one particular subset of the population, the reported cases appear to be unrelated, making it very hard to reconstruct the etiology of the outbreak.

Yes, sometimes reality is weirder than fiction. Ad if you are curious about the premise of my new book Gene Cards, you can read the first chapter here.

[1] Kim H, Kang B, Hwang S, Lee SW, Cheon DS, Kim K, Jeong YS, & Hyeon JY (2014). Clinical and enterovirus findings associated with acute flaccid paralysis in the Republic of Korea during the recent decade. Journal of medical virology, 86 (9), 1584-9 PMID: 24114945

[2] Zangwill KM, Yeh SH, Wong EJ, Marcy SM, Eriksen E, Huff KR, Lee M, Lewis EM, Black SB, & Ward JI (2010). Paralytic syndromes in children: epidemiology and relationship to vaccination. Pediatric neurology, 42 (3), 206-12 PMID: 20159431