The viruses inside us

Dendogram of endogenous retroviruses. Source: Wikipedia.

Last month I posted a discussion on a PNAS paper that reported the discovery of a new class of viruses, called pithoviruses, found in a layer of Siberian permafrost. In their paper [1], the researchers conclude:

"Our results further substantiate the possibility that infectious viral pathogens might be released from ancient permafrost layers exposed by thawing, mining, or drilling."

I found this possibility intriguing both from a scientific point of view as well as a sci-fi point of view: there are plenty of books out there on zombies and aliens, but what about ancient viruses that thawed from the ice thanks to global warming?

An attentive reader, though, didn't buy the sci-fi "threat" and asked in the comments whether viruses are necessarily bad. Normally we think of viruses as pesky little things. And while most will make us sick for a short time only, some can indeed be deadly, and others can inflict long-term complications.

The reader who asked that question, however, is absolutely right: over the course of evolution, viruses have been beneficial to us. Viruses have driven genetic diversity by transferring genes across species, and in fact, we still carry remnants of viral genes in our DNA, comprising roughly 8-10% of our genome. They are called "endogenous retroviruses", or ERV.

In the rest of this post I will address two questions:

• What are those viral genes doing in our genome?
• How did they get there?

What are viral genes doing in our genome?

Most of them are doing nothing. They are "deactivated", meaning they do not code for proteins. Our genome is made of many redundant elements that over the course of evolution were silenced because no longer useful, only to be turned on again later on when a new adaptation happened.

One such example is the placenta, where endogenous retroviruses have been found to be expressed [2-4] and play a role in the growth and implantation of the tissue. We can only speculate on why retroviral genes are expressed in the placenta, but the hypothesis is indeed quite interesting: in order to survive, retroviruses debilitate the immune system. In general, this is not a good thing for the body, except in one very special instance: an embryo is literally a parasite growing inside the mother's body. It carries extraneous DNA and, under normal circumstances, something carrying extraneous DNA would be considered an antigen and attacked by the immune system. Therefore, the expressed viral proteins found in the trophoblasts, the outer layer of the placenta, would have the role of suppressing a possible immune reaction against fetal blood.

Another property viruses have is that of cell fusion: they literally "merge" cells together into one membrane. A second hypothesis is that this property is used during the development of the placenta to build a barrier between the maternal circulation and the fetal circulation.

How did viral genes end up in our genome?

A virus enters the body of a host with the sole purpose of replicating. In order to do so, viruses hijack the cell's own replicating machinery. Retroviruses in particular carry strands of RNA which, once injected inside the cell, are turned into DNA that is then carried inside the cell nucleus and integrated into the cell's genome. This ensures that once the cell replicates, the bit of viral DNA is replicated too.

There is a special set of cells, however, such that when the virus infects them it literally gets stuck. These cells are the gametocytes, a.k.a. oocytes in women, and spermatocytes in men, which do not duplicate unless they get fertilized. But by then the virus is no longer active. It's literally stuck, in the sense that the integrated viral DNA now cannot replicate and cannot escape the host's DNA. It's just a bit of non-functional DNA that gets duplicated along as the embryo grows. The new individual now carries the viral genes in every cell of his/her body, even in the gametocytes, and hence the viral genes will be inherited by future generations as well.

And that's how viruses ended up in our genome a long, long time ago and have literally become "evolutionary fossils." In fact, by looking at these endogenous retroviral sequences, scientists are able to reconstruct the evolution of ancient viruses.

References

[1] Legendre, M., Bartoli, J., Shmakova, L., Jeudy, S., Labadie, K., Adrait, A., Lescot, M., Poirot, O., Bertaux, L., Bruley, C., Coute, Y., Rivkina, E., Abergel, C., & Claverie, J. (2014). Thirty-thousand-year-old distant relative of giant icosahedral DNA viruses with a pandoravirus morphology Proceedings of the National Academy of Sciences, 111 (11), 4274-4279 DOI: 10.1073/pnas.1320670111

[2] Emerman M, & Malik HS (2010). Paleovirology--modern consequences of ancient viruses. PLoS biology, 8 (2) PMID: 20161719

[3] Dunlap KA, Palmarini M, Varela M, Burghardt RC, Hayashi K, Farmer JL, & Spencer TE (2006). Endogenous retroviruses regulate periimplantation placental growth and differentiation. Proceedings of the National Academy of Sciences of the United States of America, 103 (39), 14390-5 PMID: 16980413

[4] Dupressoir A, & Heidmann T (2011). [Syncytins - retroviral envelope genes captured for the benefit of placental development]. Medecine sciences : M/S, 27 (2), 163-9 PMID: 21382324

Ice caps melt, prehistoric virus escapes. No, it's not a movie.

Last week I talked about the connection between global warming and the Zika virus. This week I'll discuss another interesting side effect we might observe in the next decade thanks to global warming. The ice caps will melt. Big deal, we already knew that. But have you ever thought of the stuff trapped in that ice that's going to thaw? What if some of that stuff isn't really dead, just dormant, waiting to come back? Sounds like fiction, but it's not.

Up until a few years ago the general notion was that viruses were small. How small? Let's think in terms of genome units: viruses usually carry a handful of genes, either coded into DNA or RNA, and you can think of these as longs strings of four letters: A,C,T (or U if it's RNA), or G. The letters are called nucleotides, and the genome of most common viruses is typically in the order of tens of thousands of nucleotides long. By comparison, the human genome, with its 3 billion nucleotides, is enormous.

The notion of viruses being "small" compared to living cells was turned upside down with the discovery of megaviruses in 2010 (over one million bases) and, in 2013, of the pandoraviruses, a family of viruses that can reach a staggering 2.5 million bases in genome size.

Before you freak out: so far these gigantic viruses have only been found in unicellular organisms called amoebas, not in humans or any other animals. Amoebas acquire their nutrients through phagocytosis and that's also how the gigantic viruses infect them: the cell membrane forms a vesicle around the particle and engulfs it.

The two specimens of pandoraviruses were found in shallow water sediments, one in Chile and the other one in Australia. They were both so big that they could be visible by optical microscopy, reaching 1 μm in length and 0.5 μm in diameter. Now to the interesting bit: the researchers found over 2,000 genes in these pandoraviruses, of which over 90% looked nothing like any other previously known gene. In fact, they appear to be unrelated to the previously discovered megaviruses. So what are they? A fourth domain of life? A completely isolated niche in the tree of life? Or could they be -- as the sci-fi writer in me wants to think -- the remnants of a completely different form of life, one that existed so long ago that these gigantic particles are all there is left of it?

Ok, I thought I was original when I posed that question, but I wasn't. The researchers who'd first discovered the pandoraviruses wondered about the exact same thing and, in order to find an answer, they went digging through fossils. They found a giant virus (which they named pithovirus) in a sample of Siberian permafrost radiocarbon dated to be over 30,000 years old. And I have to say, they beat me in sci-fi imagination because they go as far as to claim that there may be more gigantic viruses frozen out there that could be released from the ice as global warming takes over. *Insert apocalyptic soundtrack here*

The researchers took a sample of Siberian permafrost layer (corresponding to late Pleistocene sediments older than 30,000 years) and used it to inoculate a particular culture of amoebas (called Acanthamoeba castellanii). Lo and behold, they indeed observed particles of a prehistoric giant virus called pithovirus multiplying in the amoeba culture, making it the most ancient eukaryote-infecting DNA virus revived to date! The observed viral particles were amplified and examined through transmission electron microscopy and were found to have many similarities with the pandoraviruses, only they were even bigger. Contrary to pandoraviruses, though, these pithoviruses showed many more similarities to present-day viruses that normally infect humans and animals. This prompted the researchers to raise the alarm:

"Our results further substantiate the possibility that infectious viral pathogens might be released from ancient permafrost layers exposed by thawing, mining, or drilling. Climate change in the Russian Arctic is more evident than in many other regions of the world. Whereas the average global temperature has increased by 0.7 °C during the last 100 y, the average temperatures of the surface layer of Arctic permafrost have increased by 3 °C during the same period."

As the authors themselves put it,

"This work is a reminder that our census of the microbial diversity is far from comprehensive and that some important clues about the fundamental nature of the relationship between the viral and the cellular world might still lie within unexplored environments."

Now, if you'll excuse me, I think I just got an idea for the next bestselling post-apocalyptic thriller.

Philippe, N., Legendre, M., Doutre, G., Coute, Y., Poirot, O., Lescot, M., Arslan, D., Seltzer, V., Bertaux, L., Bruley, C., Garin, J., Claverie, J., & Abergel, C. (2013). Pandoraviruses: Amoeba Viruses with Genomes Up to 2.5 Mb Reaching That of Parasitic Eukaryotes Science, 341 (6143), 281-286 DOI: 10.1126/science.1239181

Legendre, M., Bartoli, J., Shmakova, L., Jeudy, S., Labadie, K., Adrait, A., Lescot, M., Poirot, O., Bertaux, L., Bruley, C., Coute, Y., Rivkina, E., Abergel, C., & Claverie, J. (2014). Thirty-thousand-year-old distant relative of giant icosahedral DNA viruses with a pandoravirus morphology Proceedings of the National Academy of Sciences, 111 (11), 4274-4279 DOI: 10.1073/pnas.1320670111

The Zika outbreak: a wake-up call about climate change?

People are still talking about the Ebola virus and its deadly outbreak in West Africa, and now a new virus is making the headlines: Mostly innocuous and fairly unknown until a few weeks ago, the Zika virus is suddenly dominating the news. Under scrutiny is the virus's putative link with a congenital birth defect called microcephaly, which causes babies to be born with abnormally small heads and undeveloped brains.

Two recent publications [1,2] have documented finding the genome of the Zika virus in the amniotic fluid and brains of fetuses affected by microcephaly from three different mothers. These numbers are still too small to constitute a proof, and in fact, alternative explanations are already cropping up: an organization of Argentinean doctors has published a report in which they claim that it's not the virus, rather the insecticide used against the mosquitos, that causes the birth defect.

But what is Zika and, if the claims about microcephaly turn out to be true, how can it be harmless to most people yet so detrimental to a developing fetus? To answer these questions we have to take a step back and understand how viruses work and why some are endemic in the population, while others seem to come and go in waves.

The Zika virus was first isolated in 1947 from a rhesus monkey and from a pool of mosquitos in the Zika forest in Uganda. It belongs to the same family of viruses as dengue, yellow fever, and West Nile virus. However, unlike its close relatives, Zika was thought to be relatively harmless: most infected people experience no symptoms and a few have just a rash and mild fever. Originally confined to Africa, Zika started expanding to Asia in 2007. Since then the virus has spread exponentially.

Viruses like Zika are similar to Ebola in that they replicate in animal populations, where they are endemic. Ebola, for example, usually infects bats and jumps to humans who consume meat from infected animals. Zika is found in monkeys, and both monkeys and humans contract it through bites from mosquito carriers. To evade the host's immune system, viruses evolve continuously: as organisms build immunity to fight them off, genetic changes enable viruses to escape the newly made defenses.

Most of the people who contract Zika don't even realize they've been infected. They might just notice a pesky mosquito bite. But that pesky bite hints at the virus's covert strength: once inside the mosquito, the virus becomes an invisible enemy, one that hides and migrates through a tiny insect. You can avoid infected people when you see them sniffing and sneezing, but how do you avoid a symptomless agent that spreads through a flying bug?

You don't. In areas where these mosquitos flourish, children get infected early in life, build immunity against the virus, and don't worry about it ever again.

Then why is Zika posing a threat now?

The problem arises when the virus moves to a new geographical area and encounters a population that has never been infected before. Pregnant women are particularly at risk: unless they've been infected earlier in life, in which case their immune system can clear the infection before it reaches the fetus, any disease agent that has the ability to cross the placenta is a potential threat. That's true of Zika. Despite its normally mild symptoms, when it reaches the completely naïve immune system of a fetus in the early stages of pregnancy it can potentially cause permanent damage.

Although the connection between microcephaly and Zika has yet to be confirmed, Los Alamos National Laboratory virologist and epidemiologist Brian Foley does not believe that pesticides are responsible, as hinted by the Argentinean report.

"Of course the insecticide application is slightly correlated," Foley says, "because Zika, dengue, and other similar viruses are spread by mosquitoes. So, wherever you find one, you'll find the other, too. The insecticide mentioned in the Argentinean report has been in use since before 2000 and was heavily tested for mammalian toxicity before being put into use. And it is used all over the world for mosquito control, not just in Argentina and Brazil."

"We can't exclude that Zika is responsible for microcephaly in areas where it has circulated longer. To detect such links takes careful reporting and record keeping, and most countries do not have really accurate reporting to a central database."

The truth is, both the insecticide use and the virus are consequences of a global trend: over the past two decades, vector-borne viruses like Zika and yellow fever have spread globally at an increased rate. Why? That human behavior is once again responsible for this new spread comes as no surprise. Increased traveling between continents, a rapidly growing population and, last but not least, a rise in temperatures have created the perfect conditions for mosquitos--and hence the diseases they carry--to spread virtually unstopped. Humid, densely populated areas riddled with stagnant water become the ideal habitat for these bugs.

The race for a vaccine has started, and several companies have already announced a schedule to begin human trials in the near future. Unlike HIV, for which making a vaccine has turned out much more challenging than originally anticipated, the genome of the Zika virus is not very diverse. However, making any vaccine is regulated by strict government safety rules that require years of testing. "Under normal circumstances, it takes 10-20 years to make a vaccine," Foley explains. "In an emergency situation, they could push it to two to four years. That's still a long time in the event of an outbreak."

It's even longer if you think that Zika may only be the tip of the iceberg of a phenomenon we are bound to see over and over again in the near future.

"The distribution, transmission, and abundance of vectors that bear and transmit diseases are being enhanced by global warming," Foley and colleagues state in a recent publication [3]. "The mean global temperature increased approximately by 1 degree centigrade during the last several hundred years. However, during the next 20 years it is anticipated to increase by 2 to 3 degrees centigrade."

Geographic areas once too cold for mosquito-borne diseases are now seeing an increase in encephalitic viruses, dengue, and West Nile. Similarly, Zimbabwe and Ethiopia are experiencing an increase in typhoid and cholera due to poor hygiene, stagnant water and climate change.

So yes, a vaccine can provide a solution. But if this is only the beginning, we need to think globally. It's not just one virus we're fighting but a global change that's happening too fast for the natural world to adapt on its own.

Elena E. Giorgi is a computational biologist in the Theoretical Division (Theoretical Biology group) at Los Alamos National Laboratory and the author of the science fiction thrillers Chimeras, Mosaics, and Gene Cards. This content was reviewed by Los Alamos National Laboratory and approved for release under LA-UR 16-20983. For more information, please contact the Los Alamos National Laboratory Communication Office.

References
[1] Mlakar J, Korva M, Tul N, Popović M, Poljšak-Prijatelj M, Mraz J, Kolenc M, Resman Rus K, Vesnaver Vipotnik T, Fabjan Vodušek V, Vizjak A, Pižem J, Petrovec M, Avšič Županc T. N Engl J Med. 2016 Feb 10. Zika Virus Associated with Microcephaly. PMID: 26862926

[2] A. S. Oliveira Melo, G. Malinger, R. Ximenes, P. O. Szejnfeld, S. Alves Sampaio andA. M. Bispo de Filippis. Zika virus intrauterine infection causes fetal brain abnormality and microcephaly: tip of the iceberg? Ultrasound in Obstetrics & Gynecology. Vol 47 Issue 1. DOI: 10.1002/uog.15831

[3] Paul Shapshak , Charurut Somboonwit, Brian T. Foley, Sally F. Alrabaa, Todd Wills, John T. Sinnott (2015). Zika Virus. Global Virology I - Identifying and Investigating Viral Diseases Springer-Verlag

The fossils hidden in our genome: geneticists turn into archeologists ... sort of.

I often blog about viruses because, well, I work on viruses. Here's a quick summary of things I've blogged about that I find absolutely mind-blowing:

1. About 10% of the human genome is made of genes we inherited from viruses that had replicated in our ancestors millions of years ago.

2. Viruses evolve as their hosts evolve (The Red Queen Effect), and in fact we can retrace their evolution in parallel with that of their hosts. The same is true within a single host, enabling us to retrace the evolution of a single virus in parallel with that of the host's antibodies.

3. Genes expressed by viruses and bacteria in our body can affect our phenotype.

4. We can use the ability of viruses to target certain cells to devise new cancer therapies.

5. We can use viruses to edit the genome of certain cells and cure genetic defects through gene therapy.

So yes, viruses are cool and they play a huge role in evolution. The fact that roughly 10% of our genome is made of viral elements (called human endogenous retroviruses, or HERVs) makes our DNA a "living fossil": these are viruses that infected our ancestors millions of years ago. Retroviruses in particular insert their genome inside the cell's DNA in order to replicate. In some instances, these viral genomes got stuck inside germ line cells and that's how they got passed on to the host's offspring and became part of our DNA.

Today these viruses are extinct, as they evolved into new forms, but by investigating the inactivated genes they left in our genome, researchers can find out what they looked like millions of years ago. It's like digging out fossils in our own cells.

It's exactly what two scientists from The Rockefeller University did with one family of HERVs in particular, HERV-K(HML-2) believed to have replicated in human ancestors less than one million years ago (making it one of the most recent forms found in the human genome). They looked at several of these genes across different subjects and reconstructed a "consensus genome", in other words, a genetic sequence that at each DNA position had the nucleotide most frequently found across all study subjects.

For example, if the samples across all subjects looked something like this, with the differences, highlighted in red (made up sequences!!):

then the consensus sequence would be one of the sequences without red mutations because they represent the majority, in other words:

GATACTTGGACAGGAGTTGAAGCTATAATAAGAATTCTACAACAACTGCT

Back to the HERV study, which was published in PLoS Pathogens in 2007, Lee and Bieniasz recreated the HERV-K consensus from ten full-length HERV-K(HML-2) sequences and then reconstituted the virus in the laboratory. The ten sequences were selected based on their similarity to HERV-K113, a relatively young and intact HERV-K provirus. While all ten sequences had defects that made viral genes inactivated, selecting the most frequent base at each position, eliminated these defects and yielded a full genome sequence (the consensus) with intact proteins. This derived consensus sequence may not be 100% identical to the actual virus that was integrated into the human genome close to a million of years ago, but it's pretty close. This "closeness" was confirmed in the lab when the scientists saw that the virus they reconstructed based on the consensus genome was indeed able to infect T cells in vitro. All proteins of the reconstructed virus were functional and able to carry one the virus's replication cycle.

It's like Jurassic Park... for viruses. :-)

Lee, Y., & Bieniasz, P. (2007). Reconstitution of an Infectious Human Endogenous Retrovirus PLoS Pathogens, 3 (1) DOI: 10.1371/journal.ppat.0030010

Are we really evolving into super-humans?

© EEG

I came across an article on the Popular Science website, which, turns out, is the excerpt of a new book on evolution by Science Guy Bill Nye. From the reviews I gather that Bill Nye is an excellent writer and, being also an entertainer, he knows how to not only expose well but also infuse some good humor to what he says. That's all fantastic. But while the article starts off with some rigor, his conclusion had me roll my eyes. Because, even though he does include some speculations that he himself labels the "science fiction future of human evolution" (which of course I agree is always fun to do), by the end of the article he's doing science fiction without calling it science fiction. So I'd like to take the chance to discuss what I did not like of the excerpt from his book.

Nye starts off asks the following question:

Is there a Homo superius just around the next corner, waiting to take our place?

This is the part of the excerpt that I contest:

We cannot step away from evolution. Our genomes are always collecting mutations, and we are always making mate selections. Are humans preferentially mating with other humans who are tall? Blonde or not blonde? Are smart people actually producing significantly smarter offspring, who end up making more money and ever so slowly outcompeting other families? [. . .] I'm looking out for big changes that come from good old-fashioned Darwinian natural selection. What trait would give a future human baby such an edge that she or he will grow up to produce some amazing new kid that can do something that stands out and will attract a similarly worthy partner with whom to mate? 

I understand Nye wants to make an impact on people who love science and in particular those who don't have a technical background to understand the nuisances of a scientific theory but still appreciate the importance of scientific rigor. The purpose of his book is to make people think, "This is cool. I totally get evolution." At the same time, I do believe that anyone attempting to popularize such a debated topic should go the extra length to make sure everything he/she says is rigorous, because if it isn't, it becomes easy target for those people who, instead, want to contradict it.

My points in particular are:

1) In his book he gives examples to illustrate evolution in action that are beautiful and clear and make valid points on how evolution works. But those changes have taken tens, sometimes hundred thousands of years to take place. Yes, you can draw the same examples from viruses and bacteria, but again those organisms evolve on a much faster clock than we do. So, you can't just blatantly extrapolate those examples and speculate, based on those, what will happen in the next few decades or centuries to the human species. There aren't "big changes that come from good old-fashioned Darwinian natural selection" on the time scale he's looking at. Nothing really changes on a scale of 100 years -- that's roughly only 4 generations. On the other hand, there are other things that are changing scarily fast and will hugely impact our lives in the next 100 years: climate, for example. Food and water are likely to get scarcer. And given how fast those are changing compared to how evolution works, the sad reality is that there is no adaptation that can save us this time. If the climate were changing on a scale of tens of thousands of years we could predict a new adaptation to the rising temperatures. But on this scale? Our only hope is technology and our own good will to fix things we've badly broken.

2) Intelligence. First of all, intelligence doesn't make us any more resistant to any pathogens and in particular not to the antibiotic resistant ones. The last Ebola strain that jumped from bats to humans did not ask the target person his or her IQ before infecting them. Intelligence might prompt you to vaccinate yourself and your kids, but so long as the vast majority of the people still believe in vaccines we have herd immunity protecting even the non-vaccinated people. On the other hand, there are many social constraints that put a cap on how "intelligent" the human species can be. Social events are valued more than isolated hours of working/studying/researching, and if you look back at the lives of people who've made a difference in science, literature or medicine (just to name a few), you'll see a common pattern: they were pretty unsociable. They chose their one passion over spending time with family and friends. Those are isolated cases because again, as a species, we have social constraints that only a few outliers escape.

3) "We are always making mate selections," says Bill Nye.
No, we aren't. Single individuals make mating choices under geographical and socio-economic constraints. We, as a species, make no choice. Even though cultural and socio-economic constraints are pretty stable, interbreeding has always happened and it's not going to stop now that geographical mobility has greatly increased compared to 200 years ago. When you look at the individual level you see choices. When you zoom out and look at the species level it's all random. And of course mutations appear randomly, but those who do reach fixation through this process they do so because of random drift, not because of mating choices, especially in today's globalized world.

Rather than mating choices, we need to look at geography, as Coop et al. have done in a paper in PLoS Genetics:

It seems likely that selection in humans is generally not divergent enough to generate large frequency differences at individual loci between population pairs that are either recently separated, or regularly exchange migrants. Furthermore, populations may be too mobile, or their identities too fluid, to experience very localized pressures consistently over the several thousand years that may be required for large allele frequency changes [3].

Does that mean that selection is no longer happening?

Selection and adaptation are of course still happening, but under very particular conditions. Nye does mention a few in his article: the Spanish Flu and the Black Death. Those events inferred a selective sweep on the human genome. But you can't just mention those and forget what happens in between those selective sweeps because that actually covers the majority of our evolutionary history. Most of the mutations found in our DNA have reached fixation through random drift, yet you never hear people say that. So many evolution "experts" out there go on and on on how every single gene in our DNA has been selected and perfected through evolution. This argument, not only is simply not true, but it makes evolution an easy target for the creationists because they (rightfully) say it's wrong. Random mutations, just because they are random, can be either favorable or not depending on the environmental conditions.

The mutation that causes a disease called sickle cell anemia is an interesting example: people are affected only when they carry the mutation on both gene copies. Heterozygous people, who carry the mutation only on one gene copy, are healthy. Since the disease significantly reduces the life span of affected people, under normal conditions, you would expect a deleterious mutation like that to gradually disappear from the population. So why is it still quite prevalent, especially in sub-Saharan Africa?

A study (you can read the whole post here) compared two African populations and saw that the population where the mutation was more prevalent had a lower incidence of malaria. It's only a hypothesis, but this could possibly mean that, under particular circumstances (i.e. endemic malaria), the mutation actually confers an advantage on healthy people who carry it on one gene only -- a phenomenon called heterozygote advantage. Now, this is selection in action. However, notice that the study was conducted on isolated African populations. In fact, the smaller the population, the faster selection acts. Unfortunately, in today's world there are only few pockets left of isolated human populations.

Another study I discussed a few months ago was able to find the effect of selective sweeps caused by historically documented epidemics in the genomes of the Rroma people. This population was ideal for this kind of analysis because over the centuries they remained ethnically homogeneous and only rarely intermingled outside of their group. In fact, one can retrace the migration of ancient populations looking at the people's genome, a concept pioneered by the great population geneticist Luigi Luca Cavalli Sforza.

We can definitely retrace the past, but the question is: can we really predict the future?

What would really help the debate is to hear the voices of real scientists, but real scientists get all technical and frankly what Bill Nye is saying when he envisions a super-intelligent human walking on Mars is far more appealing to the collective imagination than the concept of a handful of random mutations accumulating in our DNA. And as a science fiction writer, I get that because I do love to push the imagination. But then let's not call it science, let's call it what it really is: science fiction.

I'm writing all this not to criticize Bill Nye who's a science enthusiast working on spreading the beauty of science. And I do reckon that he has to do put a bit of this stuff in his book or else no publishing house would accept it. But they wouldn't accept it because us, the scientists, are once again failing to communicate not just the real science but the enthusiasm for (and the value of) scientific thinking.

Thoughts?

[1] Salih NA, Hussain AA, Almugtaba IA, Elzein AM, Elhassan IM, Khalil EA, Ishag HB, Mohammed HS, Kwiatkowski D, & Ibrahim ME (2010). Loss of balancing selection in the betaS globin locus. BMC medical genetics, 11 PMID: 20128890

[2] Hafid Laayounia,1, Marije Oostingb,c,1, Pierre Luisia, Mihai Ioanab,d, Santos Alonsoe, Isis Ricaño-Poncef, Gosia Trynkaf,2, Alexandra Zhernakovaf, Theo S. Plantingab, Shih-Chin Chengb, Jos W. M. van der Meerb, Radu Poppg, Ajit Soodh, B. K. Thelmai, Cisca (2014). Convergent evolution in European and Rroma populations reveals pressure exerted by plague on Toll-like receptors PNAS DOI: 10.1073/pnas.1317723111

[3] Coop G, Pickrell JK, Novembre J, Kudaravalli S, Li J, Absher D, Myers RM, Cavalli-Sforza LL, Feldman MW, & Pritchard JK (2009). The role of geography in human adaptation. PLoS genetics, 5 (6) PMID: 19503611

The heritability of fears

Cyborg © EEG

As many of you know, one of my favorite topics here on the blog is epigenetic inheritance, i.e. the mechanisms that regulate changes in gene expression that can be passed from one generation to the next. Epigenetics has revolutionized the way we look at genetic inheritance: Darwin had taught us that the only way the environment can shape the genome of a species is through natural selection. While this is certainly still true, today we also know that:

1) Most of the mutations we see in a population have reached fixation through random drift -- the constant reshuffling from one generation to the next -- not selection.

2) The environment can induce changes in one generation that may indeed be passed on to the next generation not through actual changes in the DNA but, rather, in the way the DNA is "packaged" inside the cell nucleus (for a great explanation on how this work, see my colleague Karissa Sanbomatsu's TED talk).

 In a Nature Neuroscience paper [1], authors Dias and Ressler explored the following premise in a mouse model:

"An important, but often ignored, factor that influences adult nervous systems is exposure of parents to salient environmental stimuli before the conception of their offspring. Such information transfer would be an efficient way for parents to ‘inform’ their offspring about the importance of specific environmental features that they are likely to encounter in their future environments. However, this would necessitate the transgenerational inheritance of environmental information via the germ line by offspring not even conceived at the time."

The researchers used olfactory fear as the stimulus mostly because it's one of the best understood mechanisms, both at the neurological and the molecular biology levels. Of course, a caveat would be that humans, besides being very different from mouse models, they've evolutionarily replaced olfactory stimuli with visual ones.

The researchers used odor-naive male mice and targeted an odorant receptor (M71) whose expression in the olfactory sensory neurons has been shown to be activated by acetophenone. It is important to note that the experiment did not induce any change in the actual DNA of the mice. What they did, instead, was use acetophenone to activate the receptor so it would be expressed inside these special neurons.

As I explained in older posts, DNA is wrapped around "spools" called histones. Cells produce proteins and activate receptors depending on what genes are on the outer surface of the "histone yarn", while hidden parts of the DNA remain unexpressed (as if that gene didn't exist). A molecule like acetophenone can induce changes inside olfactory sensory neurons that cause the histones to move and expose the gene that encodes the M71 odorant receptor. Once this happens, the receptor is "activated."

 Since the mice are initially odor naive, their M71 receptor is inactivated (the gene is not expressed) prior to the exposure to acetophenone. After the receptor activation, these male mice were mated with odor naive females. So, genetically speaking, the offsprings had no reason to have the M71 receptor activated, since neither parent had it activated at birth. Yet the offsprings of the mice stimulated with acetophenone, despite not being previously exposed to any of the odors with which they were tested, were able to detect acetophenone at lower concentrations than the offsprings of mice stimulated with another molecule (propanole).

Not all offsprings were behaviorally tested. Some of the offsprings were kept naive to any exposure so that their neuroanatomy could be tested separately without risking the results to be affected by the behavioral tests. When they looked at the offsprings of the acetophenone exposed mice, the researchers found an increase in the M71 glomerular area together with a significant increase in the numbers of M71-activated olfactory sensory neurons in the main olfactory epithelium.

So, how these epigenetic changes get inherited? To address the question, Dias and Ressler examined the sperm of the acetophenone exposed mice. This part of the paper gets a little technical, but the interesting idea is that they did find molecular changes in the sperm DNA around the Olfr151 gene, which encodes the M71 receptor. They found that the 3' end of Olfr151 was significantly less methylated in the acetophenone induce mice. At the same time, they

"did not observe any histone-mediated epigenetic signatures around the M71 locus when chromatin was immunoprecipitated with antibodies that recognize histone modifications that either permit or repress to transcription."

The authors conclude:

"In summary, we have begun to explore an under-appreciated influence on adult behavior—ancestral experience before conception. From a translational perspective, our results allow us to appreciate how the experiences of a parent, before even conceiving offspring, markedly influence both structure and function in the nervous system of subsequent generations. Such a phenomenon may contribute to the etiology and potential intergenerational transmission of risk for neuropsychiatric disorders, such as phobias, anxiety and post-traumatic stress disorder."

[1] Dias, B., & Ressler, K. (2013). Parental olfactory experience influences behavior and neural structure in subsequent generations Nature Neuroscience, 17 (1), 89-96 DOI: 10.1038/nn.3594




Tweet

Sex, Genes, and Rock 'N Roll: Dr. Rob Brooks talks about how evolution has shaped the modern world

My guest today is an evolutionary biologist "who thinks about sex for a living": his job consists of exploring "the evolutionary and ecological consequences of sexual reproduction." Dr. Rob Brooks, a professor at the University of New South Wales, in Sydney, Australia, studies how evolution shapes many aspects of our life, like mate choice, the costs of being attractive, the reason animals age, and the links between sex, diet, obesity and death.

I just finished reading Dr. Brooks' book Sex, Genes & Rock 'n' Roll: How Evolution Has Shaped the Modern World, a fascinating journey into human habits and cultures seen under an evolutionary perspective, and I thoroughly enjoyed it. I confess it also left me pondering with some questions, and that's why I am so thrilled to have Dr. Brooks as a guest today on CHIMERAS!

EEG: Some of the research interests listed on your UNSW page are: "the evolution of mate choice, the costs of being attractive, sexual conflict, the reason animals age and the links between sex, diet, obesity and death." Besides publishing important papers, you turned these topics into a beautiful book that, without ever getting technical, describes who and what we are in evolutionary terms, weaving in genetics and animal studies. When and how did you get the idea to write Sex, Genes and Rock n' Roll?

RB: I’ve long wanted to write popular science books about evolution that both entertain and educate people who don’t get to think about evolution and at the same time to present new ideas for how my field of research might help us understand who we are. I especially wanted to demolish this reflexive habit we have of seeing things as either cultural or biological in origin. It’s an obstacle that prevents the biological and social sciences from learning from one another. So in early 2009, I was approached by Stephen Pincock, then a publisher at NewSouth, because he had heard about my research and wanted to commission some science books. He helped me get over that initial hurdle of conceiving the book and getting a contract to write it. It was very exciting, because without his nudge I might never have started writing.

EEG: Your book touches many issues in our society: obesity, excessive consumption, teenage excess, disruptive behaviors, etc. For each, you make connections to evolution and reinterpret them under an evolutionary point of view. I can't help but wonder, though, how much "progress" has skewed evolution over the past 200 years. For example: many diseases no longer affect us thanks to vaccines; many "fit" couples choose not to have kids; and mostly, our "self-consciousness" has led us to change the course of selection in many instances. Your take, though -- correct me if I'm wrong -- is that these very same behaviors can be explained from an evolutionary point of view. Is human kind, then, like Oedipus who ends up fulfilling its fate by trying to escape it? Or is it more that we "are what we evolve into" no matter what we do ... ?

RB: We very much “are what we evolve into”. The thing about evolution is it is a consequence of a banal historic process whereby some individual leave more descendants than others. Or more precisely some genes leave more copies of themselves than others. So you can tell where a population has been, but it is impossible to tell where it’s going to go. We can make rough predictions, based on which kinds of traits are related to reproductive success today, but the environment is ever-changing, and the relationships are complex. We know, for example, that there has been rapid adaptation to high carb diets since the industrial revolution, even in 4-5 generations, and so I would predict – if compelled – that various adaptations by which people avoid the foods that cause obesity, shed excess energy and also cope with the extra weight might currently be under selection. If the current obesity crisis persists, we will almost certainly adapt to it. But nobody can be quite sure how.

Yes, medicines alter the way selection operates, but they too are part of the environment now.

EEG: But take for example the natural tendency that we have, as a species, to maintain a 1:1 male to female ration, and yet the numerous disruption introduced by human behavior. It seems to me that the 1:1 male to female ratio is a stable point and no matter what we do (for whatever reason), there are forces that inevitably bring us back there...

RB: It’s true that the ‘Fisher condition’ restores population sex ratios to near parity in a very stable way, but the Trivers-Willard process means it can be highly adaptive for skewed sex ratios under certain economic conditions. And unfortunately the economic cues can persist and give effectively the wrong message as they are doing in northwest India, where so many families are behaving like the extreme high-caste individuals with ever-increasing tragic consequences. It will probably take a generation for the lack of prospects for sons to turn into a cultural change that restores value to daughters sufficiently.

EEG: What will your next book be about?

RB: I’m writing about the conflicts inherent to sex and why they make sex and family life so ridiculously complicated.

EEG: I'm already intrigued. I'll be on the look out for your next book!

If you, too, don't want to miss Dr. Brooks' next book, you can check out his website or follow him on Twitter. Dr. Brook also blogs on The Conversation.

Carnival of Evolution, Edition #71: A Theory of Evolution or the Evolution of a Theory?

Today I'm hosting the 71st edition of the Carnival of Evolution, a monthly event where to share and discuss recent articles and blog posts about evolution. The next edition will be hosted by Adam Goldstein over at The Shifting Balance of Factors blog. You can submit post links on the Carnival Facebook page.

We start with a question that's more complex than it sounds: is modern evolutionary theory "Darwinian"? John Wilkins, at Evolving Thoughts, digresses on the positive and negative meanings that the word "Darwinian" has garnered over the past decades. Unlike religion and doctrines, theories change and evolve as our understanding of phenomena deepens and the technology we use to measure and probe gets better. As such, the theory of evolution has evolved and grown, too, since Darwin set its foundations.

A lot has happened since Darwin published On the Origin of Species. Today's evolutionary theories are drawn from the conjoint effort of many fields: genetics, populations genetics, phylogenetics, epigenetics -- and the list goes on. (And no, phylogenetics do not support intelligent design, despite what some might argue, as reported by David Morrison over at The Genealogical World of Phylogenetic Networks.)

Many contributions to the field come from theoretical models, like the one presented in a recent paper by Roesti et al. (Mol Ecol., 2014, Mar 18). Parallel adaptation is the phenomenon when species from a common ancestor adapt "in parallel" to similar environments. This phenomenon is common in fish: species like the threespine stickleback for example have readapted to river water from marine ancestors. Marius Roesti and colleagues have modeled this parallel adaptation through a "twin-peak and valley model", which he discusses on the Eco-evolutionary dynamics blog.

"Born" in 1942, when CH Waddington coined the term fusing the words epigenesis and genetics, the field of epigenetics is also gradually reshaping the way we think of evolution. Epigenetics makes us rethink heritability, as some changes in gene activity can be passed on to future generations even though they are not encoded in the DNA. In fact, recent studies indicate that some traits can be inherited through gut microbiota.

One of the central ideas in evolutionary theory is fitness. Different phenotypes have different fitness, which is measured in the average number of offspring. Imagine a set of genetic loci, each of which determines a certain phenotype. Any mutation at any one locus changes the phenotype and comes with either a fitness cost or a benefit. One can represent this through a "fitness landscape", a bi-dimensional plane with peaks and valleys: each point on the plane represents a phenotype and the z-axis represents its fitness. With this set-up, the way a phenotype has evolved accumulating a certain number of mutations throughout evolution can be represented as a path in the landscape. Using fitness landscapes, Bjørn Østman and Randy Olson created a video to visualize evolution in action on the Beacon Center blog. You can see more fitness landscapes demonstrating sympatric speciation ("the process through which new species evolve from a single ancestral species while inhabiting the same geographic region") on Randy Olson's blog.

As organisms evolved, some characteristics got lost: "nearly every animal phyla contains at least some species that consistently regenerate all or certain tissues and structures," yet this ability is lost in humans. Tissue regeneration is a fascinating field to study as its mechanisms could help us treating neurodegenerative disorders, spinal cord injuries, and limb amputations. In a blog post on the Beacon, Shawn Luttrell discusses his research at the University of Washington in understanding the morphological and genetic mechanisms of tissue regeneration in Ptychodera flava.

The fact that theories evolve means that definitions need to evolve, too. On his blog, Bjørn Østman discusses how often we disagree on simple definitions, as is the case with "species", for example, which he proposes to substitute with a "criterion" instead of a "definition."

What does Darwinism mean to you? You can join the discussion by filling the survey here.

If you're unsure about the answer, check out the historical quotes Joachim Dagg listed on his blog, Ecology & Evolution Footnotes.

And finally, let's not forget evolution's building blocks: this past Friday, April 25, was DNA day. So, happy DNA day everyone! Until next time!

EDIT: Apparently there was a misunderstanding in the new submission process and I had missed some of the links people submitted. I apologize for that and I'm listing them here below as I have just seen them and haven't been able to read the articles:

• Jason Goldman talks about the Gynosome, a new kind of sexual organ.
• Charles Goodnight gives us a reprise on contextual analysis, a recap on the phenotypic approach and a discussion on kin selection. Charles also writes an interesting essay on indirect effects, individual traits and contextual traits.
• John Hawks talks about Machiavellian intelligence.  
• Abbie Smith talks about animated fitness and how it's a "jack in the box" for nerds. 
• The discovery of a well preserved 325-million-year-old shark-like fossil from Paleozoic Arkansas provides insight into shark evolution. A post by Janet Fang.
• Henry Gee talks about how variation is maintained in populations and the savannah hypothesis. 
• Judge Starling discusses the bimodal distribution. 
• Bradly Alicea shares three case studies on Intra- and Inter-generational Physiological Evolution.

Carnival of Evolution to be hosted here on CHIMERAS!

Fellow science bloggers, the next Carnival of Evolution will be hosted right here on CHIMERAS on May 1st. The Carnival of Evolution is a monthly event that highlights some of the most interesting blog posts about biological evolution. The Carnival is hosted by a different blog every month. You can find last month's Carnival here.

So wear your Darwinian hats and send the links to your evolution blog posts to eegiorgi (at) gmail.com or submit them as a comment to the Facebook page. You can also submit the links in the comments here.

Can't wait to read!

Converging genes reveal how plagues have shaped our genome

Evolution is shaped by numerous factors. Selection is one of such factors, but, contrary to popular belief, it is not the only force acting on genomes. I cringe when I hear the expression "this gene has been selected for" because most of our alleles (we all have the same genes, but each gene can have different alleles across different ethnic groups/populations) haven't been selected at all. Things change even without any selection pressure from the environment, a phenomenon known as random drift. every new generation is a (more or less) random sample from the previous generation, and this constant resampling ensures a background change in allele frequencies, even without any selection pressure from the environment.

Because selection is not the only factor that shapes evolution, it is hard to look at how our genome evolved and pin point what changes were due to selection and which ones weren't. However, there are some rare situations where scientists get lucky. One such example is the Rroma people, also known as Gipsies. This ethnic group originated from Northern India and migrated to Europe around 1,000-1,500 years ago. Because throughout the centuries they remained a homogeneous group and rarely mingled with the local population, when looking back at some of the historical plagues that swept through Europe, the Rroma offer a unique snapshot of a distinct population undergoing the same selection pressure as the locals.

Here's the logic: alleles found in the Rroma population but not in their Indian ancestors must have risen recently in the Rroma population. If those alleles are also found in the local population, which are not related to the Rroma, then these alleles must have risen independently in the two populations. But how, if the two populations did not intermerry? Well, if you think about it, the part of our body that's most certainly under selection pressure is the immune system: a strong immune system enables the survival of not just one individual, but also of his/her offspring if they inherit the right alleles. Historical plagues that swept through Europe exerted a strong selection pressure on the immune system at the population level. Individuals with favorable alleles were able to survive these plagues, whereas the others succumbed. So, when the researchers found alleles that had risen independently in the Rroma and in the local population, they concluded
that they had been selected by severe epidemics in Europe.

The study, published in PNAS last week [1], aimed at finding "convergent evolution" between the two coexisting but genetically distinct populations. Convergent evolution means that, under selection pressure (such as for example a widespread epidemic), distinct genomes are forced to converge independently to the same allele because that particular allele confers protection against the epidemic.

"We hypothesized that despite their different ethnic and genetic backgrounds, the strong infectious pressure exerted by the major epidemics of the last millennium (of which epidemics of plague are probably the most significant) has led to convergent evolution: specific immune genes, selected during these European epidemics, become signatures that differ from those found in the Northwest Indian populations from whom the Rroma have derived [1]."

Laayouni et al. [1] found several gene clusters under positive selection, of which one in particular (TLR1, TLR6, and TLR10) code for receptors that modulate responses to Yersinia pestis, the bacterium responsible for the bubonic plague.

Hafid Laayounia,1, Marije Oostingb,c,1, Pierre Luisia, Mihai Ioanab,d, Santos Alonsoe, Isis Ricaño-Poncef, Gosia Trynkaf,2, Alexandra Zhernakovaf, Theo S. Plantingab, Shih-Chin Chengb, Jos W. M. van der Meerb, Radu Poppg, Ajit Soodh, B. K. Thelmai, Cisca (2014). Convergent evolution in European and Rroma populations reveals pressure exerted by plague on Toll-like receptors PNAS DOI: 10.1073/pnas.1317723111

Sex Is Always Well Worth Its Two-Fold Cost

Title borrowed from Feigel et al. [1].

Sex is costly. In an asexual population, all individuals bear offsprings, resulting in a higher growth rate than in a sexual population (two-fold cost of sex). Finding a partner is risky, costly in terms of energy and resources, and it results in sexual selection which may not always favor survival. Finally, in sexual populations each individual passes only 50% of its genetic make-up to their offsprings and, furthermore, genetic recombination could break-up alleles that are in an epitastic relationship with one another (they are advantageous when together, but once separated they may incur into fitness loss).

However:

"The advantages of sexual reproduction stem from quite various roots. For instance, sex increases genetic variability by recombination of the parental chromosomes. It makes a population more resistant against many unpredictable threats, such as deleterious mutations, parasites, a fluctuating environment, or competing groups. It also optimizes the evolutionary search for the best gene combinations in a single individual (epistasis) [1]."

Let's try an understand this better. Different alleles in the genome are not always independent, as they may affect fitness in conjunction, a mechanism called epistasis. For example, two alleles may be beneficial together, but their benefit may be lost when separated by a recombination event. Or, it could be the other way around, that a mutation arises under certain constraints, and it's not until paired with a second mutation that it becomes beneficial. This is often observed in drug resistance, for example. A mutation that confers the organism (a virus, or a bacterium) drug resistance could potentially make it less fit (for example, if it makes the organism more "visible" to the immune system). In these cases, often one observes a new mutation arise in conjunction with the drug-resistant one, and the two together restore the organism's original fitness. These secondary mutations are called compensatory mutations because they compensate for the original loss of fitness.

Recombination of genomes can go either way: it can bring beneficial mutations together, or, it can break them apart. In a Nature Genetics review [2], the authors mention a study done on segmented viruses: in this case, "sex" is equivalent to two viruses co-infecting the same cell, as when this happens the enzyme that replicates the genes jumps back and forth between the two genomes and the resulting new genome is a reshuffle of the two parental ones. The advantage of using viruses to study the effect of sex is that you can compare the result of sexual reproduction versus asexual reproduction in the same population. In the case of the segmented virus study, it was observed that an adverse mutation was slower to get cleared in the sexual population than the asexual one.

The same review cites studies done on yeast that yielded mixed results: some showed that sex did increase the rate of adaptation of the population, and some showed the opposite. A paradox? Not quite, if you throw into the picture the size of the population.

"Two recent studies have also tested the effect of recombination on the rate of adaptation in evolving microbial populations. When populations of C. reinhardtii that initially lacked genetic variation were allowed to adapt to a novel growth medium in sexual and asexual populations of varying size, sex increased the rate of adaptation at all population sizes, but particularly in large populations [2]."

Another study done on sexual and asexual yeast strains, compared adaptation in two environments: the mouse brain, which represented a highly variable environment, and a test tube with minimal growth medium.

"When sex was induced, the sexual strain won the competition in the mouse brain but not in the test tube, despite the fact that it also showed general adaptation to this environment. These results indicate an advantage to sex during adaptation to variable or harsh environments [2]."

Despite all these studies, it is still unclear what drove the evolution of sex. Did sex prevail thanks to epistasis? Or was it just drift, the random accumulation of mutations due to pure chance? More recent studies have looked at a combination of mechanisms that may have been responsible for the rise in sexual populations. For example, other aspects to account for, besides epistasis and drift, are redundancy and genome complexity. As organisms have evolved, their genomes have increased in size and complexity. Redundancy allows for more than one gene or pathway to have same function, buffering the effect of deleterious mutations. It also maintains a reservoir of non-coding allele variants that are always available in the search for new evolutionary pathways. At the same time, sex and recombination together cause genomes to be more robust and overcome the short-term disadvantage in favor of long-term advantages like increased evolvability.

[1] Alexander Feigel,, Avraham Englander,, & Assaf Engel (2009). Sex Is Always Well Worth Its Two-Fold Cost PLoS ONE DOI: 10.1371/journal.pone.0006012

[2] J. Arjan G. M. de Visser & Santiago F. Elena (2007). The evolution of sex: empirical insights into the roles of epistasis and drift Nature Genetics Review DOI: 10.1038/nrg1985

Ms. Stick Insect

Image credit: funkman.org.

 
You're looking at a stick insect, a critter I was quite used to growing up as my dad, an evolutionary biologist, used to grow them at home. I know, most households have cats, dogs, guinea pigs and rabbits; ours had cats, dogs, toads, fruit flies, and stick insects. :-)

Children have a tendency to personify everything, animals in particular, so imagine my shock when my dad told me that stick insects are all... ladies. Yup. It's Ms. Stick Insect. And the reason why I mention this is that today I'd like to talk about sex. Ha! You didn't see that coming, did you?

How does an all-female population manage to reproduce? Embryos develop from eggs using parthenogenesis, without the need to be fertilized. This doesn't mean that the offsprings will be identical to the parent. "Reshuffling" of genes is still ensured by meiosis.

In organisms that reproduce sexually, meiosis produces gametes, cells that carry half of the chromosomes and therefore, once fused with the opposite sex gamete, it will produce a cell with the full number of chromosomes. In organisms that reproduce sexually, meiosis produces gametes, cells that carry half of the chromosomes and therefore, once fused with the opposite sex gamete, it will produce a cell with the full number of chromosomes. In diploid organisms (organisms that have two copies of each chromosome), meiosis takes place in the following steps: (i) DNA replication, which creates two exact copies of each chromosome; (ii) pairing of the chromosome homologs, one maternal and one paternal; (iii) the homologs' cross-over creating a unique mix of maternal and paternal DNA; (iii) another round of cell division creates four cells, each with one set of chromosomes.

In parthenogenesis meiosis, step (i) is skipped. In order to restore the two copies of chromosomes, in some perhenogenetic animals, the cell division in step (iv) creates two cells instead of four, each with two copies of chromosomes. However, stick insects employ a different strategy: step (iv) still creates four cells, of which only one has the cytoplasm. This cell then fuses with one of the other three effectively creating and egg with two copies of chromosomes, perfectly equivalent to a fertilized egg.

Not all stick insects reproduce through parthenogenesis. Some populations do have males and mate, though usually only about 10% of offsprings come from sexual reproduction. Morgan-Richards et al. [1] compared several populations of New Zealand stick insects (C. hookeri), and found that while mated females produced male and female offsprings in equal numbers, virgin females that reproduced via parthenogenesis produced mostly females. That's right, I said "mostly".

"A single male hatched from an egg laid by a captive virgin mother. [...] This male may have arisen by the loss of an X chromosome during cell division (non-disjunction), a mechanism recorded for other stick insect species with the same XO⁄XX sex-determination mechanism seen in C. hookeri [1]."

So even in completely parthenogenetic populations, in principle sexual reproduction is not completely lost as the reshuffling provided by meiosis can, occasionally, originate a male offspring. Furthermore, the authors confirmed a geographical distribution of the parthenogenetic population of stick insects compared to the sexual ones: all female populations in New Zealand tend to be more common farther away from the equator and at higher altitudes, implying the adaptive advantage of parthenogens in certain environments but not in others.

The fact that parthenogens would have an adaptive advantage intrigued me, so I dug a bit further and found out about a concept called the two-fold cost of sex. In a sexual population, only one of the two sexes bares offsprings, while in a one-sex population all individuals bare offsprings, hence significantly increasing its growth rate. This seems to indicate that asexual populations have a higher Darwinian fitness. So, how did we end up with so many sexual species given especially that we all originated from asexual ancestors? How can sex be evolutionary successful when the odds seem to be against it?

I'll save that discussion for the next post. :-)

[1] MARY MORGAN-RICHARDS,, STEVE A. TREWICK,, & IAN A. N. STRINGER (2010). Geographic parthenogenesis and the common tea-tree stick insect of New Zealand Molecular Ecology DOI: 10.1111/j.1365-294X.2010.04542.x

Limb regeneration: a lesson from salamanders

As much as we would love to enlist limb regeneration among modern science's best accomplishments, so far it is still very much confined to science fiction. That doesn't mean it won't happen, though. Key to limb regeneration is cellular reprogramming that allows differentiated cells to return to a germline-like (undifferentiated) state. Genes involved in embryonic development need to be reactivated in order to restart the same process that created the limb during the growth of the embryo.

The vertebrates with the best ability to regenerate limbs are salamanders, making these little critters the most studied in the field. When a salamander loses a limb, a layer of epidermis grows to cover the wound, and beneath this layer new, undifferentiated cells start proliferating, forming a mass called blastema. Recent research shows that this first wave of cell dedifferentiation may recapitulate events occurring during embryogenesis.

"The cells in the limb blastema are believed to be a heterogeneous collection of dedifferentiated cells that have been reprogrammed to achieve varying levels of developmental potential exhibited by the cells involved in embryogenesis [1]."

Germline stem cells are cells that give rise to gametes (the reproductive cells) and have the ability to divide into another stem cell as wells as a more differentiated cell. This mechanism, called asymmetric division, is controlled by a protein called PIWI through small, non-coding RNAs called piRNAs. In [1] Zhu et al. showed that when salamanders regenerate a limb, a germline-like state is established in the growing tissue. In particular, they found that germline-specific genes were expressed in the regenerated limb. In order to show this, they looked specifically at the PIWI proteins.

Zhu and colleagues found a significant amount of upregulated transposable elements in the regenerated limbs. If you remember, transposable elements is a segment of DNA that can move from one locus to another within the genome of the same cell. During the limb regeneration process, transposable elements can impart a deleterious amount of instability, which is counteracted by a corresponding upregulation of the PIWI genes. Conversely, when the PIWI genes were knocked down (i.e. their expression was reduced) in the blastema, limb growth following the amputation was significantly reduced compared to controls.

Zhu et al. conclude

"In the future, further characterization of the subpopulations of these reprogrammed cells with additional germline-specific markers might provide more insight into exactly how far cellular dedifferentiation can proceed and whether there are indeed a small number of cells that could be isolated before a certain developmental threshold and exhibit true pluripotency when isolated from the influence of the partially programmed blastemal cells in the proximity."

[1] Wei Zhu, Gerald M. Pao, Akira Satoh, Gillian Cummings, James R. Monaghan, Timothy T. Harkins, Susan V. Bryant, S. Randal Voss, David M. Gardiner, & Tony Hunter (2012). Activation of germline-specific genes is required for limb regeneration in the Mexican axolotl Developmental Biology DOI: 10.1016/j.ydbio.2012.07.021

The sleep conundrum

How many hours of night sleep do you get? Are you ever surprised at how many more/less hours other people sleep? Well, if you are, you might find comfort knowing that the variation in number of sleep hours across species is huge and, so far, very much an evolutionary mystery.

Common thought is that sleep provides us with a much necessary "recharging" and common that it has an evolutionary advantage. However, it takes time away from foraging/preying and mating, and makes individuals more vulnerable to predators. Furthermore, the huge spread of sleeping hours across species makes it harder to pin point whether it does have a selective advantage or not.

A new paper published in Science [1] shows that at least in one bird species, pectoral sandpipers (Calidris melanotos), being able to sleep less confers an advantage: males compete for fertile females over a period of 3 weeks, during which they sleep very little. Lesku et al. showed that males who slept less were the ones who produced the most offsprings.

The researchers' main hypothesis was that

"variability in sleep duration observed across the animal kingdom reflects varying ecological demands for wakefulness, rather than different restorative requirements. According to this hypothesis, animals can evolve the ability to dispense with sleep when ecological demands favor wakefulness."

Pectoral sandpipers mate with multiple females and are not involved in the raising of their offsprings. Therefore, their mating success is determined solely on how many fertile females they have access to. Furthermore, in the high Arctic, the sun never sets during mating period. Males are awake longer than females and engage in courtship behaviors, competitions with other males, and defending their territory (don't know why, high school just came to mind. . . ahem). Their total wake time was a strong predictor of how many offsprings they ended up having. A caveat the researchers put forward is that this conclusion seems to be at odds with the hypothesis that there is a genetic basis to the duration of sleeping times, as shorter durations would be selected and hence the variation in wake time would progressively lessen. Instead, still a great variation was observed across males.

The bit that I found most intriguing is that at lower latitudes at some point darkness falls, and since most of courtship is based on visual displays, this limits the daily amount of time males can engage in such activities. However, the study was conducted in Alaska, where the sun never sets during mating season. I wonder if the same study on pectoral sandpipers that live at lower latitudes would have yielded the same results. I also can't help but wonder: this behavior was obviously selected by a favorable environment, in this case the fact that the sun never sets during summer days. I think it was this past summer that my dad said, "Would birds have ever learned to fly if it weren't for the wind?"

[1] John A. Lesku, Niels C. Rattenborg, Mihai Valcu, Alexei L. Vyssotski, Sylvia Kuhn, Franz Kuemmeth, Wolfgang Heidrich, & Bart Kempenaers (2012). Adaptive Sleep Loss in Polygynous Pectoral Sandpipers Science DOI: 10.1126/science.1220939